Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




© 2012 Plant Management Network.
Accepted for publication 3 October 2012. Published 24 October 2012.


Association of Spirea Stunt Phytoplasma with a Disease of Spiraea spp. in Minnesota


Ben Lockhart, Dimitre Mollov, and Jeltie Voth-Hulshout, Department of Plant Pathology, University of Minnesota, St. Paul, MN 55108


Corresponding author: Ben Lockhart.  lockh002@umn.edu


Lockhart, B., Mollov, D., and Voth-Hulshout, J. 2012. Association of spirea stunt phytoplasma with a disease of Spiraea spp. in Minnesota. Online. Plant Health Progress doi:10.1094/PHP-2012-1023-01-BR.


Spireas (Spiraea spp.) are woody perennial ornamentals that are widely grown throughout Minnesota and in other states due to their cold hardiness and adaptability to a variety of low-maintenance landscape settings. In the summer of 2011 plantings of spireas in numerous locations in the St. Paul-Minneapolis metropolitan area showed previously unobserved symptoms characteristic of phytoplasma-associated disease. Affected plants were severely stunted, had abnormally small leaves, and shoot proliferation (witches’-brooming) (Fig. 1). Some affected plants that were tagged in the fall of 2011 did not survive the winter and in some plantings there was a significant amount of plant mortality. These symptoms were especially evident in Spiraea japonica ‘Little Princess’ (Fig. 1). Some plants of ‘Little Princess’ and S. x bumalda ‘Anthony Waterer’ affected with the stunting disorder also tested positive by transmission electron microscopy (TEM), using partially-purified leaf tissue extracts, for presence of Spiraea leafspot virus (SLSV) and Spiraea yellow leafspot virus (SYLSV), both of which occur frequently in Minnesota (4). However, neither SLSV nor SYLSV infection has been associated with phytoplasma-like symptomatology, and some plants affected with the stunting disorder tested negative for presence of both SLSV and SYLSV by TEM using partially-purified leaf tissue extracts (4) and by PCR and reverse-transcription PCR (RT-PCR), respectively, using SLSV and SYLSV-specific primers (our unpublished data). To determine the presence and identity of phytoplasma(s) possibly associated with the stunting disorder, PCR amplification was done using the phytoplasma-specific 16S ribosomal gene primer pair P1/Tint (6) and total DNA extracted from symptomatic ‘Little Princess’ leaf tissue using a Qiagen DNeasy kit according to manufacturer’s instructions. An amplicon of the expected size (1638 bp) was obtained, sequenced (JX534223), and found to have 99% nucleotide sequence identity to the corresponding genomic region of spiraea stunt phytoplasmas and other members of the X-disease (16 Sr III) group (AF 190228). Based on the sequence of the P1/Tint amplicon a pair of internal primers designated SpPP-F (5’- TTAAGGAGGGGCTTGCGACA) and SpPP-R (5’-CGCCTACGCCTCTGGTGTTC) were designed to yield a 505-bp X-disease group-specific amplicon. Total DNA was extracted from symptomatic plants and from an asymptomatic seedling-derived ‘Little Princess’ plant as described above. The PCR reaction mixture consisted of 2 μL of template DNA, 2 μL of a 5-μM mixture of primers SpPP-F and SpPP-R, 21 μL dH20 and 25 μL of GoTaq Green Master Mix (Promega). Cycling conditions were 94°C for 2 min (1 cycle) and 94°C for 20 sec, 58°C for 20 sec and 72°C for 30 sec (39 cycles), followed by a final extension step at 72°C for 7 min. Using this procedure, a product of the expected size was obtained from template DNA extracted from symptomatic leaf tissue of S. japonica ‘Little Princess,’ ‘Norman,’ ‘Daphne,’ and ‘Little Elf,’ and from S. × bumalda ‘Anthony Waterer’ and asymptomatic ‘Little Princess’ (Fig. 2). The PCR products, obtained from ‘Little Princess,’ ‘Anthony Waterer,’ and ‘Norman’ were sequenced directly. The nucleotide sequences obtained were 100% identical to that of the predicted amplicon defined by the primer pair SpPP-F and SpPP-R.



A
 
B

Fig. 1. Symptoms in spirea stunt phytoplasma-infected Spiraea japonica ‘Little Princess.’ (A) Whole plant symptoms. (B) Infected shoot at left showing witches’-brooming and miniature leaves. Healthy shoots at right.



   

Fig. 2. PCR detection of spirea stunt phytoplasma in spireas using the primer pair SpPP-F/SpPP-R. Figure shows 505 bp amplicon obtained from Spirea japonica ‘Little Princess’ (lane 2), ‘Norman’ (lane 3), ‘Daphne’ (lane 4), ‘Little Elf’ (lane 5) and S. × bumalda ‘Anthony Waterer’ (lane 6). Lane 1: asymptomatic ‘Little Princess’ control, 100 bp DNA ladder at left.

 

Spirea stunt phytoplasma was first identified in S. tomentosa in central New York (2). This is the first report of its occurrence in non-native Spiraea spp. (S. japonica, S. × bumalda), and in Minnesota. A disease of S. salicifolia showing phytoplasma-like symptoms in Shandong, China, was associated with infection by a phytoplasma most closely related to ‘Ca. Phytoplasma ziziphi,’ the agent of witches’-broom disease of jujube (Ziziphus ziziphus) (3). A second witches’-brooming disease of spirea (S. bumalda) occurring in northern China belonged to the aster yellow (16 Sr I) group (1). Spirea stunt phytoplasma has so far not been identified outside of New York and Minnesota. Cultivated (Japanese) spireas are produced exclusively and extensively by vegetative propagation, and there is therefore a high potential for spread of this disease, and further investigation of its distribution and pathogenicity would be of interest to the commercial horticultural industry. In addition to spread by vegetative propagation, the likelihood of transmission of this disease to newly-introduced spirea cultivars merits further investigation. Transmission and proof of pathogenicity of spirea stunt phytoplasma have not been demonstrated. However, a variety of X-disease group phytoplasmas occur widely in Prunus spp. [e.g., chokeberry (P. virginiana)] and other hosts in the midwestern US and are known to be transmitted by a number of cicadellid leafhopper species including Colladanus geminatus, C. montanus, and Euscelidius variegatus (5). It would be of both scientific and practical interest to establish the fact, and assess the risk of, leafhopper transmission of spirea stunt phytoplasma and other X-disease group phytoplasmas to healthy spireas under conditions of commercial production, in order to limit spread of the disease and accompanying economic impacts.


Literature Cited

1. Gao, R., Wang, J., Li, X. D., Zhu, X. P., and Tian, G. Z. 2007. First report of spirea witches’-broom disease in China. Plant Dis. 91:635.

2. Griffiths, H. M., Sinclair, W. A., Davis, R. E., Lee, I. M., Dally, E. L., Guo, Y.-H., Chen, T. A., and Hibben, C. R. 1994. Characterization of mycoplasmalike organisms from Fraxinus, Syringa, and associated plants from geographically diverse sites. Phytopathology 84:119-126.

3. Li, Z., Wu, Z., Liu, H., Hao, X., Zhang, C., and Wu, Y. 2010. Spiraea salicifolia: a new plant host of Candidatus Phytoplasma ziziphi. J. Gen. Plant Pathol. 76:299-301.

4. Lockhart, B. E. L., and Geering, A. D. W. 2002. Partial characterization of two aphid-transmitted viruses associated with yellow leafspot of Spiraea. Acta Hort. 568:163-168.

5. Petersen, G. W. 1984. Spread and damage of western X-disease of chokecherry in eastern Nebraska plantings. Plant Dis. 68:103-104.

6. Smart, C. D., Schneider, B., Blomquist, C. L., Guerra, L. J., Harrison, N. A., Ahrens, U., Lorenz, K.-H., Seemuller, E., and Kirkpatrick, B. C. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 62:2988-2993.