Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




2010. Plant Management Network. This article is in the public domain.
Accepted for publication 3 November 2009. Published 16 February 2010.


First Report of Dicyma pulvinata on EpichloŽ typhina and Its Potential for Control of E. typhina


Stephen C. Alderman, USDA-ARS National Forage Seed Production Research Center, Corvallis, OR 97331; Sujaya Rao, Department of Crop and Soil Science, Oregon State University, Corvallis, OR 97331; and Ruth Martin, USDA-ARS National Forage Seed Production Research Center, Corvallis, OR 97331


Corresponding author: Stephen C. Alderman. aldermas@onid.orst.edu


Alderman, S. C., Rao, S., and Martin, R. 2009. First report of Dicyma pulvinata on EpichloŽ typhina and its potential for E. typhina control. Online. Plant Health Progress doi:10.1094/PHP-2010-0216-01-RS.


Abstract

The hyperparasite Dicyma pulvinata is reported for the first time on EpichloŽ typhina, which causes choke disease in orchardgrass seed production fields in the Willamette Valley, OR. In an orchardgrass field near Corvallis, OR, D. pulvinata was found on 7% of E. typhina stromata. Infected stromata had fewer perithecia and appeared shrunken, desiccated, and pale gray to grayish-white, in contrast to the orange colored noninfected stromata with mature perithecia. In greenhouse inoculations, D. pulvinata significantly (P < 0.05) reduced perithecial formation on E. typhina. However, under field conditions, a significant (P < 0.05) reduction in perithecial development occurred in one trial initiated in mid-May, but not in a second trial initiated in early June, although D. pulvinata sporulated on 92% of the inoculated stromata from each trial within 72 h after their incubation in moist chambers. Under field conditions, D. pulvinata may have potential as a biocontrol agent of E. typhina if applied when stromata start to emerge during mid late April to early May when rain and high humidity conditions are typical. However, development of D. pulvinata would likely be limited by low humidity conditions that often occur during mid- to late June in the Willamette Valley. There are currently no effective chemical or cultural controls for choke in orchardgrass.


Introduction

EpichloŽ typhina is a stroma-producing ascomycete that causes choke disease of grasses, including species of Anthoxanthum, Arrhenatherum, Brachypodium, Dactylis, Lolium, Phleum, Poa, and Puccinellia (11). Choke is a serious problem in orchardgrass (Dactylis glomerata L.) seed production in the Willamette Valley in western Oregon, where nearly every field greater than two years old is affected and yield loss can be as great as 30% (16,17). More than 95% of the United States orchardgrass seed production is in the Willamette Valley (26), and the impact of choke on this industry has growers and seed companies concerned about orchardgrass seed production and supply.

EpichloŽ typhina grows as an endophyte within the host foliage, and infected plants are asymptomatic most of the year. In the spring, as reproductive tillers begin to differentiate, E. typhina proliferates and engulfs the immature inflorescence with a felt-like fungal stroma. Infected inflorescences resemble small cattails, with stem below and healthy flag leaf above. Despite a host range that includes other grasses grown for seed in the Willamette Valley, E. typhina in Oregon has been found only on orchardgrass.

Epichloe typhina in orchardgrass differs from the typical E. typhina-host interaction in that there is no evidence of seed transmission (12,19,23). EpichloŽ typhina is heterothallic, with sexual reproduction requiring transfer of conidia of one mating type to a stroma of the opposite mating type (4,25). Flies (Botanophila spp.) are linked to EpichloŽ in a mutualistic relationship in which the flies benefit from stromata as a food source for both adults and larvae, and the fungus benefits from transfer of conidia by the flies, resulting in fertilization of stromata (3,18). The stromata are initially pale white with flat texture, but following fertilization the stromata thicken, take on a slightly rough surface, and turn from white to orange as perithecia mature. Ascospores are produced in abundance (9) and are presumed responsible for the widespread development of choke on orchardgrass within the Willamette Valley. To date, there are no effective chemical or cultural controls for choke in orchardgrass. Clonostachys epichloŽ Schroers (10) and Phyllosticta epichloes Thirumalachar (21) have been reported to parasitize E. typhina, but their potential for biological control of choke is unknown.

During the summer of 2008, a fungus was found growing on stromata of E. typhina in a greenhouse in Corvallis, OR. The objectives of this study were to identify the fungus, determine if it occurs naturally in the Willamette Valley, and evaluate its potential as a biocontrol agent for E. typhina in orchardgrass.


Isolation and identification

Infected stromata that occurred naturally in a greenhouse had fewer perithecia and appeared shrunken, desiccated, and pale gray to grayish-white, in contrast to orange colored noninfected stromata with mature perithecia (Fig. 1). Under low humidity, infected stromata appeared shrunken and desiccated, with the flag leaf also desiccated. Under high moisture conditions, or in a moist chamber, abundant conidia were produced on stromata (Fig. 2A), which appeared as a finely textured grayish-white layer on the stroma surface. Single spore isolates were obtained by touching a drop of sterile water to the sporulating surface and spreading the conidia which adhered to the drop over the surface of water agar plates with a glass rod. Colonies on PDA were pale gray- to olivaceaous gray-white with abundant conidial production. The fungus was identified as Dicyma pulvinata (Berk. & M.A. Curtis) Arx 1981 [=Hansfordia pulvinata (Berk. & M.A. Curtis) S. Hughes 1958], based on its morphology and ITS sequences.


     
 

Fig. 1. Stromata of EpichloŽ typhina infected with Dicyma pulvinata (right) and noninfected (left).

 

   
 

Fig. 2. Sporulation of Dicyma pulvinata on EpichloŽ typhina stroma, ca 30× (A), conidiophores and conidia, 200× (B), and conidium attached to conidophore, 1000× (C).


Conidiophores were translucent brown to olivaceous brown, 3-5 μm at base, tapering upwards, and branching in the upper third. Secondary and tertiary branching occurred, with conidia borne on short dendricites on the ends of conidiophores (Figs. 2B and 2C). Conidia were spherical, 5-7 μm diam, smooth, hyaline, and easily detached. The morphological features were consistent with descriptions by von Arx (2), Hughes (8), and Deighton (5) for D. pulvinata.

DNA was isolated from fungal colonies using the CTAB extraction protocol (6). Primers ITS1 (5í TCCGTAGGTGAACCTGCGG 3í) and ITS4 (5í TCCTCCGCTTATTGATATGC 3í) were used to amplify internal transcribed spacers including the 5.8S rDNA (24). Primers 18F (5í ATCTGGTTGATCCTGCCAGT 3í) and 18R (5í GATCCTTCCGCAGGTTCACC 3í) were used to amplify the 18S rDNA (15). Primers for sequencing were as follows: 1300F (5í TTGGTGGAGTGATTTGTCTG 3í), 550R (5í GAATTACCGCGGCTGCTGGC 3í) (15,22). PCR reaction mixes consisted of 1 x PrimeSTAR Buffer, 0.2 μM each dNTPís, 0.3 μM primers, 30 ng of DNA, and 1.25 U PrimeSTAR HS DNA Polymerase (Takara, Madison, WI) in a final volume of 50 μl. PCR program was: 98°C for 30 s, 30 cycles of 90°C for 10 s, 55°C for 5 s, 72°C for 2.5 min, followed by a 10 min extension at 72°C. The mixture was kept at 2°C until removal from the instrument. PCR products (ITS and 5.8S rDNA region) were cloned using the Zero Blunt TOPO PCR Cloning Kit following the manufacturerís instructions (Invitrogen, Carlsbad, CA). Plasmids were purified using the Eppendorf Perfectprep Plasmid Mini Kit (Eppendorf, Westbury, NJ) and sequenced at the Center for Genome Research and Biocomputing at Oregon State University. PCR products from the 18S rDNA region were sequenced directly. A BLAST search revealed that the ITS1 and ITS 4 regions produced alignments consistent (92 to 100% identity) with D. pulvinata isolates (Genbank accessions AY908995.1, AY908993.1, and FJ820783.1). The sequence of the PCR product obtained with ITS4 and ITS1 primers (primers are italicized) is:

TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCC
TACCTGATCCGAGGTCAAACCTGAAAAGTTGGGGTTTTAC
GGCAGGGGCTAGAGCAACTACAGAAACGAGAATAAATTA
CTACGCTTAGAGATTGCTAAAACTCCGCCAATAACTTTGA
GGAGCTGCCTTTTACAGCAGGCTCCCAACGCTAAGCAACA
GGGCTTAAGGGTTTGAAATGACGCTCGAACAGGCATGCCC
ACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCG
ATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAT
TTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCG
TTGTTGAAAGTTTTAACTTATTATGTTTTTAACTCAGAAG
TGCTAAGAATTCAAAAGAGTTTGGTATTCCACCGGCGGTC
CCGCACCCCCTAAGGAGAAGGGCGCCGCCGAGGCAACAGT
GGTAAGTTCACATGGGTTGGGAGTTTAGAAAACTCTGTAA
TGATCCCTCCGCAGGTTCACCTACGGA.


Occurrence of D. pulvinata in the Willamette Valley

To confirm the occurrence of D. pulvinata in the Willamette Valley, 100 stromata were collected arbitrarily from an orchardgrass field near Corvallis, OR, on 24 June 2008. Stromata were placed in petri dishes lined with moist filter paper. After 72 h incubation at room temperature (21 to 25°C) on a laboratory bench, the stromata were examined for presence of D. pulvinata. Dicyma pulvinata was found on seven stromata, with identification based on features of conidiophores and conidia as observed under a compound microscope at 400×.


Evaluation of the Efficacy of D. pulvinata as a Biocontrol Agent for E. typhina Under Greenhouse and Field Conditions

To establish pathogenicity of D. pulvinata to E. typhina, ten healthy, unfertilized E. typhina stromata were sprayed with a conidial suspension (1 ◊ 105 conidia/ml) of D. pulvinata (treated) and ten control stromata were sprayed with water (control) in a greenhouse. Conidia were collected in water from 3-week-old cultures grown on PDA. Just prior to inoculation, conidia were collected from stromata and redistributed among the stromata to fertilize them. Infected plants were grown from tillers removed from infected plants collected from an orchardgrass field near Corvallis, OR, two years earlier. Plants were maintained in the greenhouse and vernalized 12 weeks at 8°C with 8 h photoperiod in a growth chamber to induce reproductive tiller development, as required for initiation and development of stromata. On each plant, one to two stromata were sprayed with conidia or water. Inoculated and control plants were kept separate to avoid potential infection of controls from inoculated plants. All plants were misted by hand with a hand-held sprayer twice a day with deionized water to encourage germination and growth of D. pulvinata on the stromata. Stromata were not placed under high humidity conditions because in preliminary inoculations the high moisture conditions favored development of saprophytic fungi on the stromata as the stromata succumb to D. pulvinata. Stromata were evaluated 4 weeks after inoculation. Assessments were made visually. The orange colored perithecia were clearly in contrast to the white unfertilized portions of the stromata. An assessment key with a series of drawings of stromata with various percentages of surface area covered (shaded) was made and used to determine the percentage stroma surface with mature perithecia. Following assessment, Dicyma pulvinata was reisolated and the experiment repeated a second time. In each experimental run, a significant reduction in E. typhina perithecial development on surfaces of inoculated stromata was observed (P < 0.5, t-test) (Table 1).


Table 1. Mean percentages (+/- standard deviation) of stromatal

surfaces covered with perithecia 4 weeks after spraying

unfertilized stomata of EpichloŽ typhina with Dicyma pulvinata

(treated) or water (control).

Trial Treated Control
1   3.1 Ī 8.8 82.5 Ī 9.6   
2 12.3 Ī 16 58.8 Ī 34.5

To evaluate the potential of D. pulvinata to prevent perithecial development in E. typhina under field conditions, a conidial suspension derived from 10 single spore isolates of Dicyma pulvinata was prepared and sprayed on 12 unfertilized stromata in an established field plot of orchardgrass at the Oregon State University Hyslop Research Farm near Corvallis, OR, on 19 May 2009. A small handheld sprayer was used to uniformly apply to runoff the conidial suspension or water control. The trial was repeated on 4 June using a second set of unfertilized stromata. In each repetition, an equal number of stromata were sprayed with water as a control treatment. All stromata were collected on 24 June, stored under refrigeration and evaluated within 24 h. Stromata were assessed as in the greenhouse trial described above.

A t-test was used to compare percentage stroma surface with perithecial development among treated and control treatments. A significant (P < 0.05) reduction in stroma surface fertilized was observed in stromata sprayed with Dicyma in trial 1 but not in trial 2. At collection, Dicyma was observed sporulating on 67% of inoculated stromata from trial 1 but none from trial 2. However, following incubation of stromata in moist chambers (petri dishes lined with wet tissue paper for 72 h), D. pulvinata sporulated on 92% of stromata from each of the two trials (Table 2).


Table 2. Percentage stroma surface fertilized and percentage stromata with Dicyma pulvinata in two experimental trials in 2009.

Trial Percentage stroma
surface with perithecia

Percentage of stromata with
Dicyma pulvinata
sporulation

Treated Control At collection After 72 hr
incubation
1 79 Ī 9 90 Ī 4 67 92
2 84 Ī 9 83 Ī 9 0 92

Conclusions

To our knowledge, this is the first report of Dicyma pulvinata on EpichloŽ typhina. Results from both greenhouse and field trials indicate that D. pulvinata can cause a significant reduction in development of perithecia, although it is uncertain to what extent perithecia would need to be reduced under field conditions to significantly impact the spread of choke within or between fields. Choke was first reported in the Willamette Valley in 1997 (1); it quickly spread to adjacent fields and subsequently to nearly all fields within the valley. It is not known whether D. pulvinata preceded or followed the introduction of E. typhina in the Willamette Valley, or whether D. pulvinata parasitizes other fungi there.

Dicyma pulvinata is widely distributed geographically, including North and South America, Europe, Asia, and Australia (7). In the United States, D. pulvinata was recognized as a potential biocontrol agent of Cercosporidium personatum in peanut (13,14). Studies of D. pulvinata in peanut demonstrated its sensitivity to a broad range of fungicides. It is not known to what extent D. pulvinata would be impacted by fungicide sprays in orchardgrass.

There are currently no fungicide or cultural controls for choke in orchardgrass. The primary limitations to fungicide applications are in obtaining complete coverage of stromata, which are typically low in the canopy and covered with foliage, and in spraying stromata that emerge over an extended period of time.

In this study, D. pulvinata caused a significant reduction in perithecial development of E. typhina, although it appears that development of this hyperparasite may be limited under dry conditions. This could account for the difference in D. pulvinata development in mid-May vs. early June, in that much of June was unseasonably warm and dry. Additional field studies will be required to determine whether D. pulvinata could reduce perithecial development if it is established early in the season, e.g. late April to early May, when stromata start emerging, and whether it could then spread to parasitize subsequent emerging stromata. In addition, it is not known whether D. pulvinata would impact development of the Botanophila spp. fly larvae on the stromata. Botanophila flies are responsible for fertilization of stromata and their larvae depend on the fertilized stromata to complete their life cycle.

This report extends the geographical distribution of D. pulvinata to include the Pacific Northwest of the USA and it expands the host range of D. pulvinata to include E. typhina. The ability of D. pulvinata to parasitize E. typhina was demonstrated, although additional studies will be needed to determine the effectiveness of D. pulvinata in the management of choke disease in orchardgrass.


Acknowledgments

We thank George Hoffman, Kathryn Ackerman, and William Henson for assistance with the field evaluations and the GSCSSA for financial support.


Literature Cited

1. Alderman, S. C., Pfender, W. F., Welty, R. E., Mellbye, M. E., Cook, R. L., Spatafora, J. W., and Putnam, M. 1997. First report of choke, caused by EpichloŽ typhina, on orchard grass in Oregon. Plant Dis. 81:1335.

2. Arx, J. A. von. 1982. The genus Dicyma, its synonyms and related fungi. Proc. Kon. Ned. Akad. Wet. Amsterdam Ser. C. 85:21-28.

3. Bultman, B. L., White, J. F., Bowdish, T. I., Welch, A. M., and Johnston, J. 1998. Mutualistic transfer of EpichloŽ spermatia by Phorbia flies. Mycologia 87:182-189.

4. Chung, K. R., and Schardl, C. L. 1997. Sexual cycle and horizontal transmission of the grass symbiont, EpichloŽ typhina. Mycol. Res. 101:295-301.

5. Deighton, F. C. 1972. Synonomy of Hansfordia pulvinata (Berk. & Curt.) Hughes. Trans. Br. Mycol. Soc. 59:531-536.

6. Doyle, J. J., and Doyle, J. L. 1990. Isolation of plant DNA from fresh tissue. Focus 12:13-15.

7. Farr, D. F., and Rossman, A. Y. 2010. Fungal Databases. Online. Systematic Mycology and Microbiology Laboratory, USDA-ARS, Washinton, DC.

8. Hughes, S. J. 1951. Studies on micro-fungi. IX Calcarisporium, Verticicladium, and Hansfordia (gen. nov.). Mycolog. Papers 43:1-24.

9. Kaser, J., Rao, S., and Alderman, S. 2009. Seasonal production of infective ascospores of the choke pathogen, EpichloŽ typhina, in orchardgrass in the Willamette Valley. Dept. of Crop and Soil Sci., Oregon State Univ., Seed Prod. Res. 128:11-15.

10. Kirschner, R. 2006. New records of Clonostachys epichloŽ, a mycoparasitic fungus on the grass-parasitic ascomycete EpichloŽ typhina for Europe. Feddes Repertorium 117:307-311.

11. Leuchtmann, A. 2003. Taxonomy and diversity of EpichloŽ endophytes. Pages 169-194 in: Clavicipitalean Fungi. J. F. White, C. W. Bacon, N. Hywel-Jones, and J. Spatafora, eds. Marcel Dekker Inc., New York, NY.

12. Leyronas, C., and Raynal, G. 2008. Roles of fungal ascospores in infection of orchardgrass (Dactylis glomerata) by EpichloŽ typhina agent of choke disease. Cryptogamie Mycologie 29:11-17.

13. Mitchell, J. K., Jeger, M. J., and Taber, R. A. 1987. The effect of temperature on colonization of Cercosporidium personatum leafspot of peanuts by the hyperparasite Dicyma pulvinata. Agric. Ecosystems Environ. 18:325-331.

14. Mitchell, J. K., and Taber, R. A. 1986. Factors affecting the biological control of Cercosporidium leaf spot of peanuts by Dicyma pulvinata. Phytopathology 76:990-994.

15. Okane, I., Nakagirl, A., and Ito, T. 2001. Surculiseries rugispora gen et sp. nov., a new endophytic mitosporic fungus from leaves of Bruguiera gymnorrhiza. Mycoscience 42:115-122.

16. Pfender, W. F., and Alderman, S. C. 1999. Geographical distribution and incidence of orchardgrass choke, caused by EpichloŽ typhina, in Oregon. Plant Dis. 83:754-758.

17. Pfender, W. F., and Alderman, S. C. 2003. Evaluation of postharvest burning and fungicides to reduce the polyetic rate of increase of choke disease in orchardgrass seed production. Plant Dis. 87:375-379.

18. Rao, S., and Bauman, D. 2004. The interaction of a Botanophila fly species with an exotic EpichloŽ fungus in a cultivated grass: fungivore or mutualist. Entomol. Exp. Appl. 112:99-105.

19. Sampson, K. 1933. The systemic infection of grasses by EpichloŽ typhina (Pers.) Tul. Trans. Brit. Mycol. Soc. 18:30-47.

20. Tavares, E. T., Tigano, M. S., Mello, S. C. M., Martins, I., and Corderio, C. M. T. 2004. Molecular characterization of Brazilian Dicyma pulvinata isolates. Fitopatol. Bras. 29:148-154.

21. Thirumalachar, M. J. 1948. Some new or interesting fungi. Bull. Torr. Bot. Club 75:175-177.

22. Ueda, K., and Milata, K. 1999. A group 1 intron in the nuclear 18S rRNA gene of the yeast-like fungus Arxula terristris. IFO Res. Commun. 19:15-21

23. Western, J. H., and Cavett, J. J. 1959. The choke disease of cocksfoot (Dactylis glomerata) caused by EpichloŽ typhina (Fr.) Tul. Trans. Brit. Mycol. Soc. 42:298-307.

24. White, T. J., Burns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal ribosomal RNA genes for phylogenetics. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Snisky, and T. J. White, eds. Academic Press, San Diego, CA.

25. White, J. F., Jr., and Bultman, T. L. 1987. Endophyte-host associations in forage grasses. VIII. Heterothallism in EpichloŽ typhina. Amer. J. Bot. 74:1716-1721.

26. Wong, D. K. 2008. Forage, turf and legume seed production in the US. Online. Agriculture and Rural Development, Government of Alberta, Edmonton, Alberta.