Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




© 2010 Plant Management Network.
Accepted for publication 13 October 2009. Published 13 February 2010.


Adaptation of a Phytophthora ramorum Real-Time Polymerase Chain Reaction Assay Based on a Mitochondrial Gene Region for Use on the Cepheid SmartCycler


K. E. Sechler, M. M. Carras, N. Shishkoff, and P. W. Tooley, Foreign Disease-Weed Science Research Unit, Agricultural Research Service, USDA, Fort Detrick, MD 21702


Corresponding author: P. W. Tooley. paul.tooley@ars.usda.gov


Sechler, K. E., Carras, M. M., Shishkoff, N., and Tooley, P. W. 2010. Adaptation of a Phytophthora ramorum real-time polymerase chain reaction assay based on a mitochondrial gene region for use on the Cepheid SmartCycler. Online. Plant Health Progress doi:10.1094/PHP-2010-0212-01-RS.


Abstract

Detection of Phytophthora ramorum in US commercial nurseries has led to a number of quarantine regulations. Methods such as real-time PCR (RT-PCR) provide rapid and reliable detection that can supplement attempts to culture P. ramorum from symptomatic tissue. We adapted and optimized a previously described mitochondrial gene-based RT-PCR assay for use with a Cepheid SmartCycler v.1 and ready-to-use lyophilized PCR beads. The detection limit was 10 fg of P. ramorum genomic DNA. No cross-reactivity was observed on the SmartCycler for seven additional Phytophthora species tested, which included species known to cross-react in other assays as well as recently described species Phytophthora foliorum and P. kernoviae. The SmartCycler assay described here was used to detect P. ramorum in a set of 2008 California field samples with a high degree of accuracy.


Introduction

When Phytophthora ramorum (Werres, De Cock & Man in’t Veld) sp. nov., cause of significant oak mortality in the coastal forests of California (15,16), was recovered from a California nursery in 2001, it increased concerns that the pathogen could spread to uninfested regions of the USA through movement of infected nursery stock. Despite regulatory efforts in place in California, potentially infected material from a nationwide nursery supplier was shipped to 783 garden centers in 39 states in 2004 (19). Within a few weeks of the shipment, the United States Animal Plant Health Inspection Service (APHIS) increased restrictions (1) and sampling for the national survey to determine the pathogen’s distribution and to prevent its future spread.

Both nested PCR and real-time PCR (RT-PCR) have been developed for the detection of P. ramorum (3,6,10,11,12,13,14,18,20,22,23,24). The internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene has been widely used (8,10,11,12,24), but cross-reactivity has been observed with P. lateralis and/or P. hibernalis in these assays (3,6,10,12,20). The gene sequences of b-tubulin and elicitin can be used for detection (2), but P. lateralis has been shown to cross-react with the elicitin primers (2). The spacer region between coxI and coxII of the mitochondrial genome offers another detection target (13,22,23); this sequence is abundant and variable at the species level (13,22). Using a RT-PCR assay based on this region, no cross-reactivity was observed when tested with 45 other Phytophthora species (22) or when a number of PCR assays for detection of P. ramorum were compared in a multi-laboratory study using DNA from a standardized set of isolates of different Phytophthora species (14).

The assay described by Tooley et al. (22) was optimized for the ABI Prism 7700 Sequence Detection System, SDS (Applied Biosystems, Foster City, CA). Here, we report its adaptation to the Cepheid SmartCycler (Cepheid, Sunnyvale, CA). The SmartCycler is widely used by molecular diagnostic laboratories certified as part of the National Plant Diagnostic Network (www.npdn.org), so successful adaptation of an assay to this platform will contribute to its nationwide applicability. The goals of this study were to optimize assay conditions for the SmartCycler using ready-to-use lyophilized PCR beads, evaluate specificity by testing DNA from Phytophthora species known to cross-react in other PCR assays, and to test recently-described species Phytophthora foliorum (7) and Phytophthora kernoviae (4) to confirm that no cross-reactivity occurs in the assay.


Real-time PCR Conditions

Specific primers and probes used here were previously designed by Martin et al. (13) and Tooley et al. (22), respectively (Table 1). RT-PCR reactions were performed using the Cepheid SmartCycler v.1 and software 2.0 D (Cepheid, Sunnyvale, CA). Background fluorescence was automatically determined by the analysis software using raw data from cycles 3 to 10. Thresholds were set 10 standard deviations above the background. DNA samples were tested in a total volume of 25 µl containing reconstituted 1X OmniMix HS (Cepheid, Sunnyvale, CA), 1 µM each P. ramorum primer, and 0.15 µM PrFAM probe. Duplex PCR reactions also contained 0.1 µM each plant primer, 0.2 µM Plant CAL Red probe, and an additional 1 µM MgCl2 and 75 µM each dNTP. Both plant and pathogen probes were diluted and placed at -20°C prior to use. Cycling conditions for all PCR reactions were 95°C for 2 min and 60 cycles of 95°C for 1 s and 60°C for 30 s. Fluorescence was recorded during each annealing/extension step. Detection of CAL Red 610 was recorded through the ROX channel on the SmartCycler without additional calibration.


Table 1. Polymerase chain reaction primera and fluorescent probe sequencesb used in the RT-PCR assay for the detection of Phytophthora ramorum on the Cepheid SmartCycler.

Target Primer/probe Sequence (5’ to 3’ ) Length
P. ramorum FMPr-1x GTATTTAAAATCATAGGTGTAATTTG 26
P. ramorum FMPr-7 TGGTTTTTTTAATTTATATTATCAATG 27
P. ramorum PrFAM probe 6-FAM d(CAGATATTAAACAAATTATATATA
AAATCAAACAA) BHQ-1z
35
Plant FMPl-2y GCGTGGACCTGGAATGACTA 20
Plant FMPl-3y AGGTTGTATTAAAGTTTCGATCG 23
Plant Plant CAL
Red probey
CAL Red d(CTTTTATTATCACTTCCGGTACTG
GCAGG) BHQ-2
29

 x Primer sequences were previously described (13).

 y Probe sequences were previously described (22). Plant CAL Red reporter dye replaced CAL Orange in the previously described probe sequences.

 z Probes were labeled at the 5’ end with either the fluorescent reporter dye 6-carboxyfluorescine-aminohexyl amidite (FAM) or CAL Fluor Red 610 amidite (CAL Red 610) and labeled at the 3’ end with a black hole quencher dye (BHQ, Biosearch Technologies, Novato, CA).


Specificity of P. ramorum Primers and Probe

Genomic DNA samples from 21 isolates representing eight Phytophthora spp. (Table 2) were tested with RT-PCR. DNA was extracted from lyophilized tissue of P. ramorum, P. cactorum, and P. citricola isolates grown on a liquid synthetic medium (25). A DNeasy Plant Mini kit (Qiagen, Inc.,Valencia, CA) was used to extract DNA from the six P. ramorum isolates. DNA from isolates 384, 385, and 422 was extracted following Goodwin et al. (9). DNA from the remaining species was part of a multi-laboratory study designed to compare different P. ramorum detection assays (14). DNA concentrations for the samples extracted in our laboratory were determined using the NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Duplicate RT-PCR reactions for each isolate were tested twice using 100 pg of template DNA along with primers FMPr1a and FMPr7 and the PrFAM probe. Sterile distilled water was used as a negative control.


Table 2. Isolates of Phytophthora spp. used in this study with cycle threshold (Ct) values from RT-PCR analysis using the Cepheid SmartCycler.

Species Isolate no. (genotype) Origin Host Mean
Ct value ± SE
x
P. cactorum 384 New York
(W. Wilcox)
Fragaria x ananassa >60 ± 0y  
P. cactorum 385 New York
(W. Wilcox)
Malus sylvestris >60 ± 0   
P. cambivora P0592z Oregon Abies procera >60 ± 0   
P. cambivora P1432 Japan Malus pumila >60 ± 0   
P. citricola 422 UK (D. Mitchell) Cornus sp. >60 ± 0   
P. citricola P1817 South Africa Madia sativa >60 ± 0   
P. foliorum P10970 California Rhododendron sp. >60 ± 0   
P. foliorum P10971 California Rhododendron sp. >60 ± 0   
P. hibernalis P3822 Australia Citrus sinensis >60 ± 0   
P. hibernalis P6871 Portugal Citrus sp. >60 ± 0   
P. kernoviae P10956 UK Rhododendron ponticum >60 ± 0   
P. kernoviae P10957 UK Rhododendron ponticum >60 ± 0   
P. lateralis P3888 Oregon Chamaecyparis lawsoniana >60 ± 0   
P. lateralis P10177 Oregon Chamaecyparis lawsoniana >60 ± 0   
P. lateralis P1728 Oregon Chamaecyparis lawsoniana >60 ± 0   
P. ramorum CBS 101553 (EU1) Germany (S. Werres, BBA 9/95) Rhododendron catawbiense 23.53 ± 0.12
P. ramorum CBS 101331 (EU1) Netherlands
(S. Werres)
Rhododendron sp. 24.15 ± 0.08
P. ramorum CBS 101330 (EU1) Netherlands
(S. Werres)
Viburnum sp. 25.52 ± 0.41
P. ramorum Pr-52 (NA1) California
(D. Rizzo)
Rhododendron sp. 23.65 ± 0.21
P. ramorum 5-C (NA1) California
(N. Shishkoff)
Camellia sasanqua 25.12 ± 0.19
P. ramorum 288 (NA1) California
(M. Garbelotto)
Rhododendronsp. 25.15 ± 0.12

 x For all isolates except the six P. ramorum isolates, Ct values presented represent means of four observations, plus or minus standard error (SE). Two experiments with two replications each were conducted. Ct values for the six P. ramorum isolates represent means of eight observations; two experiments with two replications each were conducted using DNA from two separate extractions.

 y No fluorescence was detected after 60 cycles of PCR amplification when tested with 100 pg of DNA.

 z Isolates with numbers beginning with the letter P originated from the World Phytophthora Collection at the University of California-Riverside.


High specificity was observed using primers FMPr1a and FMPr7 and the PrFAM probe in a RT-PCR assay with an annealing temperature of 60°C on the SmartCycler. When multiple isolates of Phytophthora spp. were tested, only the P. ramorum isolates, three from Europe and three from the United States, had cycle threshold (Ct) values ranging from 22.91 to 27.09; all other species of Phytophthora and the water controls were not detected after 60 cycles (Table 2).


Assay Sensitivity Using P. ramorum Genomic DNA

Three experiments were conducted with the SmartCycler using serial dilutions of genomic DNA to determine assay sensitivity with and without the simultaneous amplification of plant DNA. DNA was extracted from P. ramorum isolate 288 following Goodwin et al. (9) and quantified using the NanoDrop ND-1000 Spectrophotometer. Fresh serial dilutions (1 ng to 10 ag) were prepared with sterile distilled water for each experiment. Dilution experiments were completed three times, with two repetitions tested for each DNA sample or control. Approximately 7 ng of genomic healthy azalea DNA and 100 pg of genomic P. ramorum DNA of isolate 288 were tested as controls in the second and third experiments. Sterile distilled water was used as a negative control in all experiments. Standard curves were generated for each experiment using Sigma Plot version 10.0 (Systat Software, Inc., Point Richmond, CA).

The first assay determined the limit of detection by use of a serial dilution of P. ramorum DNA tested with P. ramorum-specific primers and probe. Detection limits of the RT-PCR assay using P. ramorum primers and probe were consistent and reproducible for DNA amounts between 1 ng and 10 fg. Mean Ct values for these DNA concentrations were 18.02 to 35.40, respectively, with values differing by approximately 3.49 cycles for each dilution. Although detection for samples with less than 10 fg of DNA was possible (Fig. 1A), it was variable and therefore omitted from the standard curve analysis (Fig. 1B). Mean Ct values along with standard errors for 1 fg and 100 ag were 43.03 ± 3.43 and 46.36 ± 4.31, respectively. Amplification of water controls was not observed.


 

Fig. 1. Sensitivity of the mitochondrial gene region-based Phytophthora ramorum detection assay using the Cepheid SmartCycler. (A) Real-time PCR amplification profile for a representative dilution series of DNA extracted from Phytophthora ramorum isolate 288. (B) Standard curve of cycle threshold (Ct) values calculated from serial dilutions of P. ramorum DNA tested with the P. ramorum primer and probe set. (C) Standard curve of Ct values calculated from serial dilutions of P. ramorum DNA spiked with DNA extracted from a healthy azalea and tested with the P. ramorum primer and probe set. (D) Standard curve of Ct values calculated from serial dilutions of P. ramorum DNA spiked with DNA extracted from a healthy azalea and tested with both the P. ramorum and plant primer and probe sets. Three separate DNA dilutions were produced for each experiment and duplicate PCR reactions were tested with each dilution (n = 6). Sigma Plot version 10.0 (Systat Software Inc., Point Richmond, CA) was used for statistical analyses; standard error bars are indicated.


The second experiment determined the effect of adding plant DNA to a set of similar PCR reactions. In this experiment, each PCR reaction containing a known amount of diluted P. ramorum DNA received an addition of approximately 7 ng of DNA from a healthy azalea, Rhododendron 'Gloria.' Plant DNA was extracted using the FastDNA Kit (Qbiogene, Inc., Carlsbad, CA) and quantified using the NanoDrop ND-1000 Spectrophotometer. RT-PCR was performed with the P. ramorum specific primers and probe. Sensitivity was minimally affected as Ct values were similar to those values obtained from reactions without added plant DNA (Fig. 1C). Additionally, the slopes of the standard curves for both experiments were similar (-3.49 vs. -3.57). Neither water controls nor healthy plant DNA samples produced amplification curves.

The third assay detected P. ramorum DNA in a duplex PCR reaction containing both P. ramorum and plant primers and probes. In this experiment, samples containing both diluted P. ramorum DNA and approximately 7 ng of healthy 'Gloria' azalea DNA were tested. Sensitivity of the duplex assay was determined using the pathogen and plant primer and probe sets simultaneously. Minimal differences were observed between the FAM Ct values from this test and the previous experiments; standard curves from all three experiments were similar (Fig. 1D). All samples containing plant DNA amplified with the plant primer and probe set. The mean CAL Red 610 Ct value and corresponding standard error for samples containing between 10 ag and 100 pg of P. ramorum DNA was 28.53 ± 0.16. For reactions containing 1 ng of P. ramorum DNA, the mean Ct value with the plant probe was 34.72 ± 1.53 (SE). Sterile water controls were negative for both pathogen and plant DNA. The P. ramorum genomic DNA control amplified with only the pathogen primer and probe set. Conversely, the healthy plant DNA only amplified with the plant primer and probe set.


Dilution Series Experiments Using Inoculated Plant Material

Two separate DNA samples were extracted from infected leaves (two 6-mm diameter leaf disks) of Rhododendron ‘Cunningham’s White’ using a Qbiogene FastDNA Kit according to manufacturer’s instructions. Leaves had been inoculated with P. ramorum isolate Pr-52 using the method described by Tooley et al. (21). DNA samples were diluted with sterile water and tested using the ABI Prism 7700 SDS (22). Dilutions were stored at -20°C with limited freeze-thaw cycles and tested using the SmartCycler. Each dilution was tested in duplicate RT-PCR reactions using specific P. ramorum primers and probe. Controls of sterile water, healthy azalea DNA (approximately 7 ng), and genomic P. ramorum DNA (100 pg) from isolate CBS 101553 were also tested. Detection was possible with all dilutions and with the positive genomic DNA control, and no amplification of the water control was observed. At the lowest dilution of 10-6, the pathogen was detected with a mean Ct value of 49.79 ± 5.92 (SE) (Table 3). Using the equation of the standard dilution series curve (Fig. 1B) the initial sample was predicted to contain ca. 201 pg of P. ramorum DNA.


Table 3. Amount of DNA estimated to be present in dilutions of DNA
extracted from Rhododendron ‘Cunningham’s White’ leaf disks
infected with Phytophthora ramorum.

Dilution from
FastDNA Kit
x
Mean Ct valuey ± SE Amount of DNA calculated
from standard curve
1:10 24.00 ± 0.16 20.1 pg               
1:100 27.29 ± 0.16 2.3 pg               
1:1000 30.83 ± 0.15 222.2 fg               
1:10,000 34.55 ± 0.27 19.1 fg               
1:100,000 37.97 ± 0.74 2.0 fg               
1:1,000,000 49.79 ± 5.92 NDz

 x DNA was extracted from two 6-mm diameter leaf disks using a
Qbiogene FastDNA Kit according to manufacturer’s instructions.

 y Ct values are means of four observations, plus or minus standard
error (SE). Two separate extractions were performed (each using
two 6-mm diameter leaf disks), and two replicate RT-PCR
experiments were conducted (n = 4).

 z ND = not determined due to out of range of the standard curve.


Detection Using Field Samples from California

In a blind study, DNA from 16 field samples obtained from a variety of hosts in California in 2008 was tested using our duplex RT-PCR assay (Table 4). Samples were provided by the California Department of Food and Agriculture (CDFA), extracted using the Qiagen DNA Easy kit, and evaluated prior to our testing using culture techniques, nested PCR (8,10), and/or RT-PCR (12,24). In our laboratory, these DNA samples were diluted ten-fold and tested in duplicate RT-PCR reactions using 2 µL of freshly diluted template DNA. At least two dilutions were tested for each sample (Table 4). Controls for each RT-PCR experiment included DNA from a healthy plant, a P. ramorum-infected plant, and a P. ramorum isolate.


Table 4. Duplex RT-PCR results for plant samples collected from the field in California in 2008 and tested in a blind study.

No. Host Detection with
plant primers
Detection with P.
 ramorum
primers
CDFA deter-
mination
u
Mean Ct value±SEv Resultw Mean Ct value±SE Result Result Method
1 Arctostaphylos otayensis 23.51 ± 0.28 + 60.00 ± 0.00 + RT-PCR
2 Camellia 'Debutante' 23.80 ± 0.19 + 22.29 ± 0.01 + + culture
3 Camellia sasanqua 23.39 ± 0.17 + 32.90 ± 0.33 + + culture
4 Heteromeles arbutifolia 23.24 ± 0.11 + 60.00 ± 0.00 RT-PCR
5 Kalmia latifolia 24.52 ± 0.05 + 60.00 ± 0.00 RT-PCR
6 Laurus nobilis 21.66 ± 0.15 + 60.00 ± 0.00 RT-PCR
7 Magnolia grandiflora 22.94 ± 0.18 + 60.00 ± 0.00 RT-PCR
8 Photinia fraseri 21.75 ± 0.12 + 60.00 ± 0.00 RT-PCR
9 Rhamnus californica 22.26 ± 0.10 + 60.00 ± 0.00 RT-PCR
10 Rhododendron 'Doctor Arnold Endtz' 26.43 ± 0.19 + 39.00 ± 0.31 + +x nPCR and culture
11 Rhododendron 'Nova Zembla' 23.02 ± 0.65y + 51.55 ± 2.75 suspect + nPCR
12 Rhododendron 'PJM' 24.57 ± 0.12 + 60.00 ± 0.00 RT-PCR
13 Umbellularia californica 23.73 ± 0.20 + 34.61 ± 0.11 + + RT-PCR
14 Umbellularia californica 22.64 ± 0.14 + 34.62 ± 0.22 + + RT-PCR
15 Umbellularia californica 23.10 ± 0.14 + 29.13 ± 0.11 + + RT-PCR
16 Umbellularia californica 24.01 ± 0.08z + 57.80 ± 2.20 RT-PCR

 u Samples were collected from March to December 2008 in California and were previously processed by the California Department of Food and Agriculture using the Qiagen DNA Easy kit. The following methods were used to test for P. ramorum: real-time PCR (RT-PCR, APHIS-approved protocol) (12,24), culture, and nested PCR (nPCR) (8,10).

 v Except where noted, Ct values are means of four observations, plus or minus standard error (SE). Two experiments with two replications each were conducted.

 w Detection of the target sequence is positive (+) if the threshold was consistently crossed in each duplicated RT-PCR reaction. Negative (−) results indicate that fluorescence was not detected from multiple reactions after 60 cycles. A sample was considered suspect if it produced fluorescence after 45 cycles in duplicated reactions.

 x Positive results were obtained using both culture and nested PCR.

 y n = 6.

 z n = 7.


All 16 field samples amplified with the plant primers and probe producing mean Ct values ranging from 21.66 to 26.43 (Table 4). Six of the field samples consistently amplified with the P. ramorum primers and probe in each reaction. Mean Ct values for these samples ranged from 22.29 to 39.00. No fluorescence was detected after 60 cycles for eight of the field samples. For sample no. 11, the results agreed within replications but not between repetitions. In a third repetition both reactions were positive, however. Amplification was also observed in one of the reactions of sample no. 16, but not in the other reactions. Another repetition was run with triplicate RT-PCR reactions; no amplification was observed. Results for fourteen out of 16 samples agreed with those from the CDFA (Table 4).


Conclusions

The previous assay conducted on the ABI instrument amplified only P. ramorum and not 45 other species of Phytophthora tested (22). Despite modifications made to this assay to adapt it to the Smartcycler, P. cactorum, P. cambivora, P. foliorum, P. hibernalis, and P. lateralis did not amplify in our assay even though they have shown some degree of cross-reactivity in other PCR assays for detection of P. ramorum (2,3,5,6,7,11,12,20). Cross-reactivity was also not observed with the recently described P. kernoviae (4). We were unable to test all species of Phytophthora for cross-amplification in this assay, but believe because these most closely-related species of Phytophthora did not amplify, that other known species are also unlikely to cross-react. Actual verification of this hypothesis would require testing of all known Phytophthora species.

Similar to the results of Schaad et al. (17), the sensitivity of this assay was slightly altered when it was adapted from the ABI Prism 7700 SDS to the SmartCycler. Using serial dilutions of P. ramorum genomic DNA, the consistent detection limit on the ABI Prism 7700 SDS was determined to be 1 fg (22), while the limit found on the SmartCycler was 10 fg. Although DNA amounts less than 10 fg of P. ramorum DNA were detected by the SmartCycler, results were inconsistent and variable. The actual limit of detection is probably less than 10 fg, but values between 1 and 10 fg were not tested.

A limitation of our dilution series experiments was that we performed them from a single extraction of P. ramorum isolate 288 and did not truly replicate the entire detection assay starting with isolate culturing and DNA extraction. Thus, due to possible differences in mitochondrial numbers that may exist between different growth replications, some experimental variation that may have existed was not accounted for in our experiments. However, this potential variation, if present, unlikely had a significant impact on our assay's sensitivity. When two sets of DNA dilutions were extracted from inoculated rhododendron leaf disks and tested with RT-PCR, little variation was observed. The lowest amount detected by the SmartCycler was ca. 2 fg of P. ramorum DNA [(22) and this study], a value similar to the one determined by the ABI Prism 7700 SDS.

While assay sensitivity decreased when it was transferred to the SmartCycler, assay efficiency increased. Using the equation E = 10(-1/S) - 1, where S is the slope, PCR amplification efficiency (E) was determined (12). By transferring the assay to the SmartCycler, the efficiency of the RT-PCR reactions increased from approximately 87% [based on the slope of -3.68, (22)] to 93% (based on the slope of -3.49). However, adding plant DNA to each reaction reduced the efficiency to approximately 90%; approximately 84% in a duplex reaction. While pathogen Ct values were slightly affected by dual amplification, detection limits remained constant and are comparable to those previously observed with the ABI Prism 7700 SDS (22).

In a blind study, we tested field samples from California in 2008 previously evaluated at CDFA and found agreement in 14 of 16 samples. Possible explanations for lack of agreement for certain samples include variation in the amount of target DNA present, the potential presence of PCR inhibitors, potential degradation of the DNA sample, and/or the specificity and sensitivity of RT-PCR assays. The results demonstrate the importance of using multiple detection methods to obtain the most accurate diagnoses.

The previously described (22) RT-PCR assay based on a mitochondrial gene region has been successfully transferred to the SmartCycler platform, and is ready for extensive laboratory and field applications. This modified assay will provide an additional specific and sensitive tool for monitoring plant material for the presence of P. ramorum to limit its potential spread to new areas.


Acknowledgment

We are very grateful to Cheryl Blomquist at the California Department of Food and Agriculture for providing the field samples used in this study.


Literature Cited

1. Anonymous. 2007. 7 CFR Part 301. Federal Register Vol. 72, No. 38. USDA-APHIS, Washington, DC.

2. Bilodeau, G. L., Lévesque, C. A., de Cock, A. W. A. M., Duchaine, C., Brière, S., Uribe, P., Martin, F. N., and Hamelin, R. C. 2007. Molecular detection of Phytophthora ramorum by real-time polymerase chain reaction using TaqMan, SYBR Green, and molecular beacons. Phytopathology 97:632-642.

3. Blomquist, C. L., Irving, T., Osterbauer, N., and Reeser, P. 2005. Phytophthora hibernalis: A new pathogen on Rhododendron and evidence of cross amplification with two PCR detection assays for Phytophthora ramorum. Online. Plant Health Progress doi:10.1094/PHP-2005-0728-01-HN.

4. Brasier, C. M., Beales, P. A., Kirk, S. A., Denman, S., and Rose, J. 2005. Phytophthora kernoviae sp. nov., an invasive pathogen causing bleeding stem lesions on forest trees and foliar necrosis of ornamentals in the UK. Mycol. Res. 109:853-859.

5. Chandelier, A., Ivors, K., Garbelotto, M., Zini, J., Laurent, F., and Cavelier, M. 2006. Validation of a real-time PCR method for the detection of Phytophthora ramorum. EPPO Bulletin 36:409-414.

6. Davidson, J. M., Werres, S., Garbelotto, M., Hansen, E. M., and Rizzo, D. M. 2003. Sudden Oak Death and associated diseases caused by Phytophthora ramorum. Plant Health Progress. doi:10.1094/PHP-2003-0707-01-DG.

7. Donahoo, R., Blomquist, C. L., Thomas, S. L., Moulton, J. K., Cooke, D. E. L., and Lamour, K. H. 2006. Phytophthora foliorum sp. nov., a new species causing leaf blight of azalea. Mycol. Res. 110:1309-1322.

8. Garbelotto, M., Rizzo, D. M., Hayden, K., Mejia-Chang, M., Davidson, J. M., and Tjosvold, S. 2002. Phytophthora ramorum and sudden oak death in California: III. Pathogen genetics. Pages 765-774 in: Fifth Symp. Calif. Oak Woodlands. R. Standiford and D. McCreary, eds. USDA Forest S. Gen. Tech. PSW-GTR-184.

9. Goodwin, S. B., Drenth, A., and Fry, W. E. 1992. Cloning and genetic analysis of two highly polymorphic, moderately repetitive nuclear DNAs from Phytophthora infestans. Curr. Genet. 22:107-115.

10. Hayden, K., Ivors, K., Wilkenson, C., and Garbelotto, M.  2006. TaqMan chemistry for Phytophthora ramorum detection and quantification, with a comparison of diagnostic methods. Phytopathology 96:846-854

11. Hayden, K. J., Rizzo, D., Tse, J., and Garbelotto, M. 2004. Detection and quantification of Phytophthora ramorum from California forests using a real-time polymerase chain reaction assay. Phytopathology 94:1075-1083.

12. Hughes, K. J. D., Tomlinson, J. A., Griffin, R. L., Boonham, N., Inman, A. J., and Lane, C. R. 2006. Development of a one-step real-time polymerase chain reaction assay for diagnosis of Phytophthora ramorum. Phytopathology 96:975-981.

13. Martin, F. N., Tooley, P. W., and Blomquist, C. 2004. Molecular detection of Phytophthora ramorum, the causal agent of sudden oak death in California, and two additional species commonly recovered from diseased plant material. Phytopathology 94:621-631.

14. Martin, F. N., Coffey, M. D., Zeller, K., Hamelin, R. C., Tooley, P., Garbelotto, M., Hughes, K. J. D., Kubisiak, T., Bilodeau, G. J., Levy, L., Blomquist, C., and Berger, P. H. 2008. Evaluation of molecular markers for Phytophthora ramorum detection and identification: Testing for specificity using a standardized library of isolates. Phytopathology 99:390-403.

15. McPherson, B. A., Wood, D. L. Storer, A. J., Svihra, P., Rizzo, D. M., Kelly, N. M., and Standiford, R. B. 2000. Oak mortality syndrome: Sudden death of oaks and tanoaks. Tree Notes, Calif. Dept. of Forestry and Fire Prot., No. 26.

16. Rizzo, D. M., Garbelotto, M., Davidson, J. M., Slaughter, G. W., and Koike, S. T. 2002. Phytophthora ramorum as the cause of extensive mortality of Quercus spp. and Lithocarpus densiflorus in California. Plant Dis. 86:205-214.

17. Schaad, N. W., Gaush, P. Postnikova, E., and Frederick, R. 2001. On-site one hour PCR diagnosis of bacterial diseases. Phytopathology 91:S79.

18. Schena, L., Hughes, K. J. D., and Cooke, D. E. L.  2006. Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real-time PCR. Molec. Plant Pathol. 7:365-379.

19. Stokstad, E. 2004. Nurseries may have shipped sudden oak death pathogen nationwide. Science 303:1959.

20. Tomlinson, J. A., Boonham, N., Hughes, K. J. D., Griffin, R. L., and Barker, I. 2005. On-site DNA extraction and real-time PCR for detection of Phytophthora ramorum in the field. Appl. Environ. Microbiol. 71:6702-6710.

21. Tooley, P. W., Kyde, K. L., and Englander, L. 2004. Susceptibility of selected ericaceous ornamental host species to Phytophthora ramorum. Plant Dis. 88:993-999.

22. Tooley, P. W., Martin, F. N., Carras, M. M., and Frederick, R. D. 2006. Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Phytopathology 96:336-345.

23. Uribe, P., and Martin, F. N. 2007. Using sigmoidal curve-fitting in a real-time PCR detection assay to determine detection thresholds. Proceedings of the Sudden Oak Death Third Symposium; 2007 March 5-9; Santa Rosa, CA. Gen. Tech. Rep. PSW-GTR-214:75-81.

24. USDA, APHIS PPQ CPHST. 2005. Quantitative multiplex real-time PCR (qPCR) for detection of Phytophthora ramorum using a TaqMan system on the Cepheid SmartCycler and the ABI 7900/7000. Document Control Number WI-B-T-1-6.10-26-2005.

25. Xu, D. -Y., Huang, H., and Wang, C. -P. 1982. Polyacrylamide gel disc electrophoresis of proteins from species of Phytophthora. Acta Mycol. Sin. 1:40-47.