Search PMN  

 



Tables from:



Fisher, J, R. 2012. Identification of three distinct classes of satellite RNAs associated with two Cucumber mosaic virus serotypes from the ornamental groundcover Vinca minor. Online. Plant Health Progress doi:10.1094/PHP-2012-04XX-01-RS.



Table 1. CMV coat protein, movement protein, and satRNA PCR primers.

Primer Region
amplified
Sequence (5'-3') Expected
product
size
(bp)
CMV-MPfwd movement protein GCTYTCCAAGGTMCCAGYAGGAC 1331
CMV-MPrev movement protein GGASCGRGAACCWCKACGCGGRC 1331
CMV-CPfwd coat protein CCTTACTTTYTCATGGATGCTTC 1005
CMV-CPrev coat protein CCTTCCGAAGAAAYCTAGGAGRTG 1005
CMV-satRNAfwd satellite RNA GTTTTGTTTGWTRGAGAAYTGCGTRG 339
CMV-satRNArev satellite RNA GGGTCCTGBWRRGGWATGWRTARAC 339


Table 2. Movement protein ORF percent nucleotide (top panel) and predicted amino acid (bottom panel) sequence identities between CMV-Vinca isolates and known CMV strains.

CMV isolate Fnyx Yx SOx MY17x Z1x Rby Ky LSz Qz
N1-05t 99.3 98.1 97.7 97.2 96.6 97.2 94.4 78.4 65.4
N1-04u 98.0 97.0 96.7 96.2 95.8 96.3 93.5 78.1 64.8
N1-03v 98.6 97.4 97.1 96.6 96.0 96.5 93.6 78.3 65.2
0100w 78.6 78.6 79.3 78.7 79.5 77.9 78.3 98.8 81.3
CMV isolate Fny Y SO MY17 Z1 Rb K LS Q
N1-05t 99.4 99.1 99.1 99.1 98.7 98.8 95.7 87.7 ND
N1-04u 98.9 98.5 98.5 98.5 98.2 98.9 94.3 82.7 ND
N1-03v 98.6 98.2 98.2 98.2 97.9 97.9 95.0 86.7 ND
0100w 83.8 84.2 84.2 84.2 86.0 83.8 83.1 98.9 ND

Mean of 5t, 1u, 2v, and 3w clones. CMV subgroup 1Ax, 1By, and 2z reference sequences. ND=not determined. Shaded cells indicate highest percent identity to CMV reference sequences.



Table 3. Coat protein ORF percent nucleotide (top panel) and predicted amino acid (bottom panel) sequence identities between CMV-Vinca isolates and known CMV strains.

CMV isolate Fnyx Cx Yx MY 17x Z1x SOx Rby Ky LSz Snz WLz
N1-05t 99.2 98.7 97.2 97.8 96.6 96.3 97.7 94.0 76.5 76.3 76.3
N1-04u 98.2 97.8 96.6 97.2 96.2 95.9 97.6 93.7 76.9 76.6 76.8
N1-03v 99.3 99.0 97.4 98.0 96.8 96.4 97.8 94.2 76.5 76.5 76.3
0100w 77.0 76.6 77.5 77.2 77.6 77.8 77.2 78.5 99.3 98.8 99.1
CMV isolate Fny C Y MY 17 Z1 SO Rb K LS Sn WL
N1-05t 98.2 97.0 96.3 98.2 97.7 97.7 98.0 97.7 81.9 81.6 81.9
N1-04u 98.8 97.8 97.8 98.8 98.3 98.3 98.3 99.2 83.2 83.1 83.1
N1-03v 98.9 98.0 96.1 98.9 97.5 97.5 98.4 97.5 80.1 80.1 80.1
0100w 84.0 83.5 83.0 84.0 83.5 83.5 83.5 84.0 99.8 99.5 99.5

Mean of 2t, 8u, 2v, and 2w clones. CMV subgroup 1Ax, 1By, and 2z reference sequences. Shaded cells indicate highest percent identity to CMV reference sequences.



Table 4. Percent nucleotide sequence identities between CMV-Vinca satRNAs and known CMV satRNAs.

CMV/sat
isolate
(# nt)
N1-05s
(340)
N1-04t
(390)
N1-03u
(339)
N1-02v
(339)
N1-02w
(389)
0100x

(339)
0100y
(340)
0100z
(389)
WL2 96.2 73.4 89.8 90.1 73.3 88.7 94.8 72.6
G 92.6 71.0 87.6 87.5 70.7 87.1 91.5 71.3
B1 95.4 72.8 88.8 89.2 72.2 87.7 93.8 72.6
B2 95.1 73.2 88.4 88.7 73.3 87.4 93.5 73.1
S 94.6 73.2 89.1 89.3 73.7 83.3 93.2 72.9
Fny2 93.9 72.5 88.7 89.0 72.9 88.0 92.6 72.4
Fny1 93.6 72.8 88.6 88.9 73.0 88.0 92.4 72.4
E 93.0 72.2 88.8 88.3 72.7 88.0 93.5 72.1
B3 92.8 72.1 87.9 88.2 71.7 87.4 91.5 72.3
WL1 90.4 69.9 88.6 89.1 70.6 87.0 90.6 69.7
Ky 90.2 69.9 89.7 90.0 70.6 88.8 89.7 69.4
D 87.1 70.3 89.3 89.7 70.1 88.5 86.8 69.2
Y 74.9 71.8 74.5 75.0 72.5 73.1 74.7 71.6
T43 71.1 87.0 70.6 71.0 88.1 70.4 70.4 86.6
D27 72.3 86.9 69.2 68.2 86.8 68.8 72.0 86.2
OY2 67.7 84.4 67.5 67.1 85.0 68.6 68.4 84.1

Mean of 10s, 9t, 6u, 3v, 2w, 1x, 2y, and 1z clones. Shaded cells indicate highest percent identity to satRNA reference sequences.



Table 5. Chlorosis and necrosis domains of CMV-Vinca satRNAs compared to necrogenic (Dsat), ameliorative (WL1), and chlorosis-inducing (WL2, B1) satRNAs.

SatRNA Phenotypes nt 148-170 chlorosis domain nt 290-309 necrosis domain
148t |153v           170w
||149u                |
290 293x 299y 304z
|  |     |    |
Dsat N ACTCT-CAGTACTACACTCTCA- AAGG-CTTAT---GCTATGC
N1-03 (339 nt) NN, NC ACTCT-CAGCACTACGCACTCA- AAGG-CTTAAT--GCTATGC
N1-02 (339nt) NN, NC ACTCT-CAGCACTACGCACTCA- AAGG-CTTAAT--GCTATGC
0100 (339nt) not tested ACTCT-CAGCACTACGCACTCA- AAGG-CTTAAT--GCTATGC
WL1sat NN, A ACTCT-CAGCACTACGCGCTCA- AAGA-CTTAG---GTTATGC
T43sat N, NC ? GAACTGGCGCCGGAGGCCCTCAG AAGG-CTTAT---GCTATGC
N1-05 (340 nt) NN, NC ACTCT-CAGCACTACGCACTCA- AAAACCT-ATAAGGTCATGC
0100 (340 nt) not tested ACTCT-CAGCACTACGCGCTCA- AAAACCT-ATAAGGTCATGC
N1-04 (390 nt) NN, NC, A GAACTGGCGCCGGAGGCCCTCAG AAAACCT-ATAAGGTCATGC
N1-02 (389nt) NN, NC GAACTGGCGCCGGAGGCCCTCAG AAAACCT-ATAAGGTCATGC
0100 (389 nt) not tested GAACTGGCGCCGGAGGCCCTCAG AAAACCT-ATAAGGTCATGC
WL2sat NN, C GTTCTTCAGCACTACGCACTCAA AAAACCT-ATAAGGTCATGC
B1sat NN, C GTTCTTCAGCACTACGCACTCA- AAAACCT-ATAAGGTCATGC

 s Necrogenic on tomato (N), non-necrogenic on tomato (NN), chlorosis-inducing on tomato or tobacco (C), non chlorosis-inducing on tomato or tobacco (NC), ameliorative (A).

 t G in chlorosis satRNAs, A in non-chlorosis.

 u Chlorosis on tomato (T) or tobacco (C).

 v T in chlorosis satRNAs, deleted in all others.

 w A determines helper strain specificity of chlorosis on tomato (white chlorosis with CMV-WL and yellow chlorosis with CMV-LS), deleted in other satRNAs.

 x G in necrogenic satRNAs, A in non-necrogenic.

 y T in necrogenic satRNAs, G in non-necrogenic.

 z C in necrogenic satRNAs, T in non-necrogenic.

Blue font indicates key nucleotides involved in the necrosis and chlorosis disease states. Red font indicates variations in the CMV-Vinca satRNA isolates.





© 2012 Plant Management Network.