Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




© 2012 Plant Management Network.
Accepted for publication 30 November 2011. Published 27 February 2012.


Real-time PCR Detection of Rhodococcus fascians and Discovery of New Plants Associated with R. fascians in Pennsylvania


Ekaterina V. Nikolaeva and Seogchan Kang, Department of Plant Pathology, The Pennsylvania State University, University Park, PA 16802; Tracey N. Olson and SeongHwan Kim, Plant Disease Diagnostic Laboratory, Pennsylvania Department of Agriculture, Harrisburg, PA 17110


Corresponding author: S. H. Kim. skim@state.pa.us


Nikolaeva, E. V., Kang, S., Olson, T. N., and Kim, S. H. 2012. Real-time PCR detection of Rhodococcus fascians and discovery of new plants associated with R. fascians in Pennsylvania. Online. Plant Health Progress doi:10.1094/PHP-2012-0227-02-RS.


Abstract

Rhodococcus fascians is a gram-positive bacterium that causes bacterial fasciation on a wide range of ornamental plants. To address the need for a reliable, sensitive, and specific method for detecting R. fascians in infected plant materials, a real-time (RT) PCR assay was developed. The target for detection was fas-1, a plasmid-borne gene that is essential for virulence. DNAs from all confirmed pathogenic strains of R. fascians consistently tested positive, with detection limit of 30 fg of R. fascians DNA. In repeated PCR experiments with R. fascians pure culture, as few as 2.5 CFU were tested positive. Direct detection of R. fascians from clinical samples of Coreopsis was successful, whereas detection of R. fascians in Chrysanthemum, Pelargonium, Phlox, and Veronica required enrichment on modified D2 (mD2) medium. In the case of geraniums, as few as 10² CFU/100 mg plant tissues were successfully detected after 72 h enrichment on mD2. In total, 115 strains, isolated from 41 different kinds of flowering crops in Pennsylvania greenhouses during 1984-2010, were confirmed to be R. fascians by RT PCR. Geraniums and speedwell were the most frequently submitted clinical samples to Pennsylvania Department of Agriculture. The following are the first report of plants associated with R. fascians in PA: Ajania pacifica, Anemone sp., Aruncus sp., Baptisia sp., Eutrochium maculatum, Helianthemum sp., Lewisia sp., Monarda sp., Osteospermum ecklonis, Rudbeckia nitida, and Saponaria ocymoides.


Introduction

Rhodococcus fascians is a gram-positive plant pathogenic bacterium that causes multishoots and leafy gall formation on a wide range of ornamental plants (1,17). The disease has been reported worldwide and can severely affect the nursery industry due to lost sales, recalls, and destruction of potentially infected plants (10).

Currently, diagnosis of R. fascians in clinical plant samples relies on a combination of culturing and pathogenicity testing. A number of complications exist for this diagnostic method. Firstly, attempts to isolate and confirm the pathogenicity of isolates even from symptomatic plants have not been always successful (6,10). Additionally, treatment of ornamental plants with growth regulator during mass-production sometimes causes symptoms similar to bacterial fasciation. The current diagnostic method also is quite time consuming, as bacterial isolation from infected plant requires 5 to 7 days of growth on nutrient agar medium. Pathogenicity assays require additional 2 to 3 weeks when pea seedlings grown in test tubes are used (4,7,14) or 4 to 8 weeks when potted plants are inoculated (6,10). Moreover, inconsistent results have been reported in both pathogenicity assays (4,6,14). Our recent report (7) showed that R. fascians populations seem to consist of mixtures of cells, differentiated by the presence or absence of a virulence plasmid. The ratio of the cells with this plasmid can vary depending on cultural conditions, leading to variable disease severity. These complications call for an improved diagnostic method.

A conventional PCR, based on the plasmid-borne fas-1 virulence gene as the target for detection of virulent strains of R. fascians, was reported (14), but the sensitivity and feasibility of this method was not validated. Real-time (RT) PCR-based diagnosis methods have several advantages over conventional PCR methods and have been developed to detect several plant pathogenic bacteria, including Clavibacter michiganensis subsp. sepedonicus (12), Ralstonia solanacearum (18), Agrobacterium radiobacter (19), Xylella fastidiosa (13), and Erwinia amylovora (11). Diagnostic methods based on RT PCR do not require gel electrophoresis to analyze amplified DNA, thus shortening processing time and minimizing contamination problem. Additionally, RT PCR can facilitate the quantification of target DNA present in clinical samples. BIO-PCR (8,12,19) combines bacterial enrichment on selective or semi-selective medium with PCR, which allows detection of only viable cells of a target pathogen even at extremely low levels in the presence of other microflora and also helps eliminate PCR inhibitors from plant materials. The objectives of this study were to develop a reliable RT PCR assay to detect pathogenic R. fascians in clinical samples and to document new plants associated with R. fascians in Pennsylvania greenhouses.


Design and Evaluation of Primers and Probe

The virulence plasmid of R. fascians carries genes involved in the synthesis of a cytokinin-like molecule and is essential for the development of fasciation symptoms (3). The instability of this plasmid causes virulence variation in R. fascians populations (7). Twelve pairs of primers were designed to amplify parts of the R. fascians fas-1 virulence gene (GenBank accession number Z29635) (3) using PrimerQuest Software (Whitehead Institute for Biomedical Research, Cambridge, MA) and purchased from Integrated DNA Technologies (Coralville, IA). Among these, the Rf-229F and Rf-408R pair resulted in the lowest Ct values and was chosen for further optimizing PCR conditions. The TaqMan probe Rf-366P was labeled at the 5’ end with a reporter dye (6-FAM) and at the 3’ end with a quencher dye (TAMRA). Additionally, a conventional PCR primer pair, VicA1497F and VicA1990R, was selected out of 24 primers designed to amplify the R. fascians chromosomal virulence vicA gene (GenBank accession number AJ301559) (16). The primers used in this study are listed in Table 1.


Table 1. Sequences of the primers used in this study.

Primers Nucleotide sequences, 5’ to 3’
R. fascians fas-1, conventional PCR (14)
JPE L GGGAATTCCGACCGTATCCAGTGT
JPE R CGGGATCCATATCGAACCGCCCTC
Bacterial 16S ribosomal RNA gene (20)
P891F TGGAGCATGTGGTTTAATTCGA
P1033R TGCGGGACTTAACCCAACA
UniProbe /TexRd-XN/CACGAGCTGACGACARCCATGCA/BHQ_2/
Plant cytochrome oxidase (COX) gene (18)
COX-F CGTCGCATTCCAGATTATCCA
COX-RW CAACTACGGATATATAAGRRCCRRAACTG
COX-P /TexRd-XN/AGGGCATTCCATCCAGCGTAAGCA/BHQ_2/
R. fascians fas-1 gene (this study)x
Rf-229F ATGGCACAGACGCAAGCAA
Rf-408R GATACGGTCGGCAACAACAATC
Rf-366P /6FAM/AATTGGAAAGAGCGCCGAAGCGAGCAAGTT/BHQ_1/
R. fascians vicA gene (this study)y
VicA1497F TCTGGATCTCGAAGTGCAAACCGT
VicA1990R AGCGTACAAGGCCTTCCTGAAAGA

 x Primers were designed based on the fas-1 sequences published in a previous study (3).

 y Primers were designed based on the sequences in a previous study (16).


DNA Preparation

Genomic DNA from bacterial cultures was extracted using Bactozol kit (Molecular Research Center Inc., Cincinnati, OH) according to the manufacturer’s instructions. DNA from plant samples was extracted and purified with Qiagen DNeasy Plant Mini Kit (Qiagen, Valencia, CA). After placing plastic tubes containing 100 mg of plant tissues and glass beads in liquid nitrogen for 30 s, the tissues were ground into fine powder using TissueLyser II (Qiagen). DNA from soils was extracted and purified using UltraClean Soil DNA Isolation Kit (MO BIO Laboratories, West Carlsbad, CA). All DNA samples were stored at -20°C until analyzed. DNA Ladder I (GeneChoice, Frederick, MD) was used to estimate the concentration of DNA samples.


Optimization of RT PCR conditions

Conditions for RT PCR were optimized by testing different concentrations of MgCl2 (1 to 6 mM), trehalose dihydrate (1 to 5%), and annealing temperatures (58°C to 64°C). After optimization, each reaction (reaction volume of 25 µl) contained the following components: 240 µM dNTPs, 4.0 mM MgCl2, 1U Platinum Taq Polymerase (Invitrogen), 240 nM of each primer, 120 nM probe, 5% trehalose dehydrate, 2 µl of template DNA, and molecular grade water (MGW). Amplification was carried out in SmartCycler (Cepheid, Sunnyvale, CA). All RT PCR reactions were run as follows: one cycle at 96°C for 120 s (extracted DNA)/300 s (intact cells) followed by 45 cycles of 95°C for 5 s and 60°C for 30 s. The cycle threshold (Ct) value for each reaction was calculated automatically by determining the PCR cycle number at which the reporter fluorescence significantly exceeded the background level.

Conventional PCR amplifications were performed using thermal cycler PTC-200 (MJ Research Inc, Hercules, CA). Amplified products were visualized on 1.5% agarose gel stained with ethidium bromide using GelDok-It Imaging System (UVP, Upland, CA).


Sensitivity of Detection Using Extracted DNA and Bacterial Cells

A standard curve for quantitative analyses, constructed by amplifying ten-fold serial dilutions of a genomic DNA preparation of R. fascians strain Rf-01 (150 ng/µl), showed a linear regression between input DNA and Ct values with the regression coefficient R² of 0.995 (Fig. 1a). The RT PCR product was of predicted size (179 bp). The detection limit was 30 fg of target DNA, whereas a previously published conventional PCR method (14) produced clear bands only with DNA concentrations of 3 pg or higher.

Quantification of R. fascians cells without DNA extraction was shown to be linear by regression analysis with R² = 0.994 (Fig. 1b). A fresh culture of strain Rf-1, adjusted to optical density 0.18 at 600 nm (Perkin Elmer UV/VIS Spectrometer, Waltham, MA) using sterile MGW, was serially diluted by 10-fold increments using sterile MGW. For each dilution, three replicates of 10 µl were subjected to RT PCR and 5 to 10 replicates (10 µl) were immediately plated on solid YDC medium to determine the number of colony forming units (CFU). Three separate dilution series were tested. As few as 2.5 CFU per PCR reaction were reliably detected.


   A
   B
  Fig. 1. Sensitivity of detection of Rhodococcus fascians using extracted DNA and bacterial cells. (A) Standard curve of cycle threshold (Ct) values calculated from 10-fold serial dilutions of DNA (150 ng/µl) from R. fascians strain Rf-1. (B) Standard curve of Ct values calculated from 10-fold serial dilutions of Rf-1 cells ranging from 2.5 × 106 CFU to 2.5 × 100 CFU per PCR reaction. Three separate real-time PCR amplifications using a combination of the Rf-229F/Rf-408R primer pair and probe Rf-366P were performed for each dilution. The straight line was calculated by linear regression (Microsoft Excel).  

Specificity and Sensitivity of R. fascians Detection

To evaluate the specificity, 17 R. fascians strains, previously confirmed by sequencing their 16S ribosomal RNA (rRNA) encoding gene (7), were analyzed (Table 2). These strains were selected based on levels of virulence (highly virulent, avirulent, and weakly virulent), which was determined via the pea bioassay in our previous study (7). ATCC strain 12975 (American Type Culture Collection, Manassas, VA) was used as an R. fascians reference. DNAs from all highly virulent strains consistently tested positive, whereas no signal was detected with DNA from avirulent strains or 14 other species of plant-associated bacteria. As expected, the Ct value for weakly virulent strains was higher than that of highly virulent strains. RT PCR reactions using a probe and primers targeted for bacterial 16S rRNA gene (20) resulted in similar Ct values regardless of their virulence (Table 2). Conventional PCR with VicA1497/VicA1990 primers, targeting the R. fascians chromosomal virulence gene vicA, resulted in positive for all R. fascians strains. These control experiments confirmed that the higher sensitivity of detection for highly virulent strains was not due to higher quality and/or quantity of their genomic DNA. Our RT PCR method successfully detected weakly virulent strains that were negative or produced inconsistent bands with the conventional PCR method based on JPE R/JPE F primers (14), indicating its higher sensitivity than the conventional PCR method (Table 2). No signal was detected with plant DNA extracted from 27 known R. fascians hosts (Table 3) as templates; DNA from Aruncus dioicus, Fragaria sp., and Phlox subulata resulted in the Ct value of 36.99 or higher in some reactions, but this signal was not observed consistently.


Table 2. Effectiveness of the fas-1 based real-time PCR for detecting pathogenic Rhodococcus fascians.

# PDA bacterial strain IDt Real-time
PCR, Ct
Conventional PCR, band formation Viru-
lence
y
Fas-1u Uni-
Probe
v
JPEw VicAx
1 R. fascians, Rf-59v 15.88 16.54 + + hv
2 R. fascians, Rf-59a >40.00z 16.55 + a
3 R. fascians, Rf-29v 17.51 16.80 + + hv
4 R. fascians, Rf-29a >40.00 16.48 + a
5 R. fascians, Rf-01 16.81 17.38 + + hv
6 R. fascians, Rf-32 15.99 16.39 + + hv
7 R. fascians, Rf-86 20.10 16.28 + hv
8 R. fascians, Rf-27v 18.79 17.02 + + hv
9 R. fascians, Rf-27a >40.00 17.28 + a
10 R. fascians, Rf-44 27.98 18.52 ± + wv
11 R. fascians, Rf-36 17.56 18.66 + + hv
12 R. fascians, Rf-49 24.88 15.70 + + hv
13 R. fascians, Rf-73 21.09 19.21 + + hv
14 R. fascians, Rf-93 19.28 15.96 + + hv
15 R. fascians, Rf-90 34.38 19.88 + a
16 R. fascians, Rf-66 34.48 18.96 ± + wv
17 R. fascians, Rf-79 29.69 16.89 ± + wv
18 R. fascians, ATCC12975 31.09 16.08 ± + wv
19 Agrobacterium tumefaciens,
PDA 63162-96
>40.00 15.70 a
20 Acidovorax sp., PDA 22034-99 >40.00 17.28 a
21 Erwinia carotovora pv. carotovora, PDA 22038-95 >40.00 13.39 a
22 Pseudomonas cichorii,
PDA 80809-95
>40.00 14.46 a
23 Sphingobacterium multivorum,
PDA 83076-03
>40.00 15.71 a
24 Ralstonia solanacearum bv. 1,
PDA 82785-02
>40.00 23.57 a
25 Xanthomonas fragaria,
PDA 62121-03
>40.00 16.86 a
26 X. campestris pv. begoniae,
PDA 82351-01
>40.00 17.43 a
27 X. campestris pv. hederae,
PDA 22039-00
>40.00 14.50 a
28 X. hortorum pv. pelargonii,
PDA 24017-07
>40.00 18.67 a
29 Unknown isolate >40.00 18.14 a
30 Unknown isolate >40.00 16.65 a
31 Unknown isolate >40.00 18.54 a
32 Unknown isolate >40.00 18.34 a
33 Water (negative control) >40.00 >40.00 a

 t Strains archived at the Pennsylvania Department of Agriculture (PDA) were tested after DNA extraction with Bactozol kit:
1-17 = Rhodococcus fascians strains (v = virulent, a = avirulent isolates from the same strain), PDA Collection (Harrisburg, PA);
18 = American Type Culture Collection (Manassas, VA);
19-28 = Plant associated non-Rhodococcus strains, PDA Collection;
29-32 = Unknown yellow gram positive bacterial isolates from symptomatic plants cultured on YDC.

 u Ct value for PCR with primers Rf-229F/Rf-408R and TaqMan probe Rf-366P targeted the R. fascians plasmid-borne fas-1 virulence gene.

 v Ct value for PCR with primers P891F/P1033R and UniProbe targeted bacterial 16S ribosomal RNA gene (20).

 w Primers JPE R/JPE L targeted the R. fascians plasmid-borne fas-1 virulence gene. + = positive, − = negative, ± = faint band and/or inconsistent results.

 x Primers VicA1497F/VicA1990R targeted the R. fascians vicA virulence gene. + = positive, − = negative.

 y Virulence rating based on fasciation symptom development on pea seedlings of cv. Alaska at 14 days post inoculation: hv = highly virulent (symptom development on >75% pea seedlings); a = avirulent (no symptom development); wv = weakly virulent (symptom development on 5 to 25% pea seedlings). Based on our earlier study (7).

 z No fluorescence was detected after 40 cycles of PCR amplification.



Table 3. Real-time PCR assays with DNA from Rhodococcus fascians hosts.

# Plant Name Variety Real-time PCRw, Ct
Fas-1x Cox-Py
1 Alcea rosea Chater's Mix  >40.00z 24.38
2 Aruncus dioicus    >36.99 23.12
3 Aster sp. Hardy >40.00 22.18
4 Baptisia australis    >40.00 21.45
5 Buddleja sp. Nanho Blue >40.00 21.73
6 Calibrachoa sp.    >40.00 20.15
7 Coreopsis sp. Jethro Tull >40.00 24.96
8 Delphinium sp. Dark Blue/Dark Bee >40.00 21.31
9 Dianthus sp. Spangled Star >40.00 27.57
10 Eupatorium sp. Gateway >40.00 23.98
11 Fragaria sp. Pink Panda >38.89 21.42
12 Gaura sp. Siskioyu Pink >40.00 23.67
13 Geranium sp. Biokovo >40.00 24.34
14 Heuchera sp. Palace Purple >40.00 22.56
15 Iberis sp. Purity >40.00 22.12
16 Impatiens sp. New Guinea >40.00 22.45
17 Monarda sp. Petite Wonder >40.00 19.90
18 Nemesia sp.    >40.00 20.55
19 Oenothera sp. Missouri Primrose >40.00 21.75
20 Pelargonium x hortorum        >40.00 19.14
21 Petunia sp. Simply Madness >40.00 25.22
22 Phlox subulata Scarlet Flame >38.56 24.07
23 Pisum sativum Alaska >40.00 22.56
24 Primula japonica    >40.00 24.05
25 Rudbeckia sp. Goldstrum >40.00 21.95
26 Salvia nemorosa East Friesland >40.00 22.34
27 Sedum variegatum   >40.00 21.76
28 Verbena sp. Homestead Purple >40.00 25.67
29 Veronica sp. Icicle >40.00 22.38
30 Viola labradirica     >40.00 21.66

 w Plant DNA was extracted using Qiagen kit.

 x The Ct value for PCR with primers Rf-229F/ Rf-408R and probe Rf-336P specific for the R. fascians plasmid-borne fas-1 virulence gene.

 y The Ct value for PCR with universal COX-F/COX-RW primer pair and COX-P probe for plant DNA (18).

 z No fluorescence was detected after 40 cycles of PCR amplification.


Detection and Quantification of R. fascians in Geranium Tissues

Presence of PCR inhibitors is a common problem that hinders PCR detection of plant pathogens in plant tissues, especially in geraniums (8,19). In order to evaluate the sensitivity of R. fascians detection in geraniums, 1 ml suspensions of Rf-01 strain, in concentrations ranging from 100  to 107  CFU/ ml MGW, were mixed with 100 mg of healthy Pelargonium × hortorum leaves. These mixtures were placed on an orbit incubator-shaker (Lab-line 3529, Melrose Park, IL) for 30 min at room temperature. As a negative control, sterile MGW was used.

Three different approaches were evaluated to optimize in planta detection, including: (i) extraction and purification of DNA from plant/bacterial mixtures using Qiagen kit; (ii) direct RT PCR in the presence of BSA (200 ng/µl) and 5% trehalose dehydrate as PCR enhancers; and (iii) BIO RT PCR after enrichment of R. fascians cells using D2 medium (5), a semi-selective medium for gram-positive coryneform plant pathogenic bacteria, or YDC. In this study, the concentration of sodium azide in D2 medium was decreased to 0.5 mg/liter (mD2) because of strong inhibition of R. fascians growth at higher concentrations. For BIO PCR, ten 10-µl drops from each dilution were placed on agar plates for enrichment. After 24, 48, and 72 h of incubation at 27°C, each spot was washed with 10 µl of sterile MGW and subjected to RT PCR. Extra plates were incubated for additional 24 to 48 h to confirm R. fascians growth and to count CFU. Three independent experiments were performed.

Direct RT PCR detection of R. fascians mixed with geranium tissues was possible only in the presence of BSA and trehalose as PCR enhancers. Strong inhibition by unknown inhibitor(s) derived from geranium tissues limited positive detection only at the concentration of 107 CFU/100 mg plant tissue (Table 4). Detection of 103 CFU/100 mg plant tissue was successful when DNAs from plant/ bacterial mixtures were extracted and purified using Qiagen kit. Enrichment of bacterial cells on nutrient media was needed to detect R. fascians at lower cell concentrations. After 72 h enrichment on mD2 medium, as few as 10 to 100 cells/100 mg plant tissue were successfully detected. Semi-selective mD2 medium was more effective than YDC in the cases that plant samples were highly contaminated with fast growing gram-negative bacteria and/or fungi. As expected, the Ct values decreased with increasing incubation time on medium (Table 4).


Table 4. Detection of Rhodococcus fascians in geranium tissue samples.

R. fascians
concen-
tration

(CFU/
100mg)t
Direct RT
PCR
(Ct)yv
RT PCR after enrichment on
modified D2 medium
(Ct)uw
RT PCR
with purified DNA as templates
(Ct)ux
0 h 24 h 48 h 72 h
107 33.80 ± 3.26 24.51 ± 2.46 25.53 ± 0.86 23.48 ± 1.33 21.82 ± 1.30
106 >40.00y 26.71 ± 2.00 26.93  0.62 25.35  2.69 23.55 ± 0.00
105 >40.00 32.31  2.05 28.90  3.09 25.75  1.53 27.43 ± 0.23
104 >40.00 >40.00 31.26  2.80 26.72  2.85 30.77 ± 1.08
103 >40.00 >40.00 32.99  3.95 28.36  0.94 31.75 ± 1.70
102 >40.00 >40.00 >40.00 31.56  2.95 >40.00
101 >40.00 >40.00 >40.00 >40.00 >40.00
100 >40.00 >40.00 >40.00 >40.00 >40.00
Controlz >40.00 >40.00 >40.00 >40.00 >40.00

 t 100 mg healthy tissues of Pelargonium × hortorum were mixed with 1 ml bacterial suspension of R. fascians strain Rf-1 at different concentrations.

 u The Ct value for real-time PCR (RT PCR) with primers Rf-229F/ Rf-408R and probe Rf-366P.

 v The Ct value for RT PCR with plant/bacterial mixtures without DNA extraction.

 w The Ct value for RT PCR after enrichment of bacterial cells on modified D2 media.

 x The Ct value for RT PCR after DNAs from plant/ bacterial mixtures were extracted and purified using Qiagen kit.

 y No fluorescence was detected after 40 cycles of PCR amplification.

 z Healthy Pelargonium × hortorum tissues in 1 ml sterile MGW.


Detection of R. fascians in Clinical Samples

We have evaluated fas-1 RT PCR for fast detection and identification of R. fascians from clinical samples collected by plant inspectors and submitted to the Pennsylvania Department of Agriculture (PDA) from 2007 to 2010. Qiagen kit was used for DNA extraction and purification from infected plant tissues. Alternatively, water suspensions of infected plant tissues (100 mg tissue suspended in 1 ml of sterile MGW for 30 min) were directly subjected to RT PCR and were plated on four mD2 plates (100 µl/plate) for enrichment and pure culture isolation. The plates were washed with 500 µl of sterile water at 24, 48, and 72 h post incubation (one plate at each time point) at 27°C and tested with RT PCR. The remaining plate was incubated for additional 2 to 3 days until yellow-orange colonies appeared. Several presumptive R. fascians colonies were picked and suspended in 100 µl of sterile MGW. After vortexing, 2 µl of bacterial suspensions (~103 to 104 CFU) were tested with RT PCR. The R. fascians chromosomal gene vicA was used as an additional PCR marker to detect all R. fascians cells (regardless of the presence of virulence plasmid) in individual populations.

Direct RT PCR detection of R. fascians in plant tissues was successful for Coreopsis clinical samples, whereas the clinical samples from Chrysanthemum, Heuchera, Pelargonium, Phlox, Saponaria, and Veronica required 24 to 72 h of bacterial enrichment on mD2 medium (Table 5). The optimal time of enrichment depended on factors such as the number of R. fascians cells, the presence and relative abundance of other microbes in the samples, and the presence of PCR inhibitors from plant tissues. Enrichment on mD2 medium helped increase the sensitivity of R. fascians detection, especially for samples with low bacterial concentrations, such as distorted leaves and soil (Table 5). Considering the known instability of virulence plasmid in R. fascians populations (7), single colony fas-1 RT PCR was very useful for detecting pathogenic R. fascians in plant materials.


Table 5. Detection and isolation of Rhodococcus fascians from clinical samples in 2007-2010.

PDA
clinical sample ID
Host Part of the plant, symptoms Purified DNAuv Direct RT PCRuw Enrichment on mD2 mediumx
Real-time PCRuy Isola
-tion
z
62011-07 Veronica spicata

"Royal Candles"

Green lateral shoots at soil level 4/4 0/5 5/5 Yes
Discolored galls at soil level 4/4 0/3 3/3 Yes
Discolored lateral shoots 9/9 0/5 14/14 Yes
Roots 2/2 0/2 2/2 Yes
Green galls 4/4 0/5 5/5 Yes
Distorted leaves 9/11 0/5 9/9 Yes
2008-6-
27-0193
Veronica spicata "Sunny Border Blue" Green galls 8/8 0/2 5/5 Yes
Discolored galls at soil level 8/8 0/5 7/7 Yes
Distorted leaves 6/7 0/5 7/7 Yes
Non-symptomatic leaves 2/5 0/5 5/7 Yes
Soil 2/5 0/3 2/5 Yes
83775-07 Pelargonium graveolens Leafy-galls at soil level 2/2 0/2 2/2 Yes
Distorted leaves 1/2 0/8 8/8 Yes
Non-symptomatic leaves 1/3 0/6 5/6 Yes
83991-07 Phlox sp. Leafy-galls at soil level 1/1 nt 2/2 Yes
2008-6-
27-0191
Coreopsis verticillata "Zagreb" Green aerial abnormal shoots 2/2 7/10 10/10 Yes
Malformed flowers 2/2 0/2 3/3 Yes
Soil nt 0/4 4/4 Yes
2008-6-
27-0192
Coreopsis
rosea
"Sweet Dreams"
Malformed flowers 1/1 1/1 1/1 Yes
Crown gall 0/2 0/2 0/2 No
2009-6-
27-0028
Saponaria ocymoides "Raspberry Royal" Green lateral shoots at soil level 1/1 0/1 5/5 Yes
Soil nt 0/1 2/5 Yes
2009-6-
27-0024
Heuchera sanquinea Green lateral shoots at soil level nt 0/1 5/5 Yes
Soil nt 0/1 3/8 Yes
2010-6-
27-0153
Coreopsis sp. "Cosmic Eye" Green aerial abnormal shoots 1/1 nt 3/3 Yes
2010-6-
27-0154
Coreopsis sp. "Galaxy" Green aerial abnormal shoots 1/1 nt 3/3 Yes
n/a Pelargonium x hortorum
(healthy plant)
Non-symptomatic leaves 0/10 0/4 0/10 No

 u Real-time PCR (RT PCR) results with primers Rf-229F/Rf-408R and probe Rf-336P. Number of positive subsamples/total tested subsamples.

 v DNA from symptomatic/asymptomatic plant tissues was extracted and purified using Qiagen kit.

 w RT PCR results with bacterial suspensions, resulted after 100 mg of plant tissues were suspended in sterile MGW for 30 min.

 x mD2 medium - modified D2 medium (5) with sodium azide at 0.5 mg/liter.

 y RT PCR after the enrichment of bacterial cells on mD2 medium.

 z R. fascians cultures were isolated.


Plants Associated with R. fascians in Pennsylvania

Since late 1960s, PDA has inspected Pennsylvania greenhouses and collected samples exhibiting bacterial fasciation symptoms. All R. fascians strains archived at PDA from 1984 to 2010 were analyzed with fas-1 and vicA PCR reactions using extracted DNA. In total, 115 strains confirmed to be R. fascians by sequencing and/or RT PCR, were isolated from 41 different kinds of flowering crops in Pennsylvania greenhouses (Table 6). Geranium (zonal and scented) and speedwell were the most frequent plants among the bacterial fasciation samples submitted to PDA (29.1% and 13.6% strains, respectively).

Plants that have not been previously reported to be associated with R. fascians (Table 6) included Ajania pacifica = Chrysanthemum pacificum (Japanese Chrysanthemum) (Fig. 2A), Anemone sp. (Anemone) (Fig. 2B), Aruncus sp. (Goat’s Beard), Baptisia sp. (Wild Indigo), Eutrochium maculatum (Joe pyeweed), Helianthemum sp. (Sun Rose), Lewisia sp. (Lewisia) (Fig. 2C), Monarda didyma (Bee-Balm), Monarda sp. (Horsemint) (Fig. 2D), Osteospermum ecklonis = Dimorphotheca ecklonis (Vanstaden’s River Daisy) (Fig. 2E), Rudbeckia nitida (Coneflower), and Saponaria ocymoides (Rock Soapwort) (Fig. 2F). Symptomatic samples of these plants were found to be infected with R. fascians, which was confirmed by isolation and subsequent sequencing and detection by PCR of virulence genes. Koch’s postulates were not conducted for the individual hosts due to known inconsistency of pathogenicity tests (6,10), which is believed to be caused by the instability of virulence plasmids (7) and an ability of R. fascians to colonize plants epiphytically without causing symptoms (17). However, our previous study (7) confirmed the pathogenicity of R. fascians strains from Ajania, Aruncus, Eutrochium, Helianthemum, and Rudbeckia via pea bioassays (Table 6) (4,14).


Table 6. Plants associated with Rhodococcus fascians in Pennsylvania in 1984-2010.

R. fascians
strain ID
x
Host scientific name First record in PA RT PCRy Patho-genicity testz Ref.
Rf-29*, Rf-30*, Rf-57* Ajania pacifica = Chrysanthemum pacificum 2000 3/3 2/3 no report
Rf-121 Anemone sp. 2009 1/1 nt no report
Rf-88*, Rf-93* Aruncus sp. 2003 2/2 1/2 no report
Rf-104 Aster sp. 2002 1/1 0/1 (6)
Rf-81* Baptisia sp. 1998 1/1 0/1 no report
Rf-26* Buddleja sp. 2000 1/1 0/1 (9)
Rf-20*, Rf-66*, Rf-68*, Rf-111, Rf-113 Chrysanthemum
x morifolium
1996 5/5 3/3 (15)
Rf-94*, Rf-102*, Rf-119, Rf-127, Rf-128 Coreopsis sp. 2003 5/5 1/2 (10)
Rf-124 Cosmos atrosanguineus 2009 1/1 nt (10)
Rf-67* Delphinium sp. 1997 1/1 0/1 (6)
Rf-31* Eutrochium maculatum 2002 1/1 1/1 no report
Rf-49*, Rf-50*, Rf-86* Gaura sp. 2002 3/3 3/3 (10)
Rf-15* Gypsophila sp. 2002 1/1 1/1 (15)
Rf-40* Helianthemum sp. 2003 1/1 1/1 no report
Rf-63*, Rf-123, Rf-126 Heuchera sanguinea 1999 3/3 0/1 (6)
Rf-35*, Rf-37* Heuchera x heucherella 1999 2/2 0/2
Rf-79* Iberis sempervirens 2003 1/1 1/1 (10)
Rf-74* Impatiens sp. 1998 1/1 0/1 (2)
Rf-46*, Rf-58*, Rf-59* Leucanthemum
x superbum
2000 3/3 3/3 (6,9)
Rf-38* Lewisia sp. 2002 1/1 0/1 no report
Rf-95*, Rf-97* Monarda didyma 2003 2/2 0/2 no report
Rf-90* Monarda sp. 2004 1/1 0/1
Rf-83* Oenothera sp. 2000 1/1 1/1 (10)
Rf-14* Osteospermum ecklonis = Dimorphotheca ecklonis 2001 1/1 0/1 no report
Rf-16*, Rf-17*, Rf-18*, Rf-21*, Rf-23*, Rf-25*, Rf-85* Pelargonium graveolens 1994 7/7 7/7 (9,15)
Rf-101* Pelargonium peltatum 1988 1/1 1/1
Rf-13* Pelargonium odoratissimum 1994 1/1 1/1
Rf-10*, Rf-32*, Rf-33* Pelargonium crispum 1996 3/3 2/3
Rf-01*, Rf-03*, Rf-04*, Rf-05*, Rf-06*, Rf-07*, Rf-08*, Rf-09*, Rf-12*, Rf-24*, Rf-28*, Rf-34*, Rf-48*, Rf-51*, Rf-52*, Rf-53*, Rf-54*, Rf-55*, Rf-72*, Rf-73*, Rf-75*, Rf-82*, Rf-96*, Rf-105, Rf-114, Rf-115, Rf-118, Pelargonium x hortorum 1987 27/27 17/21
Rf-99* Pelargonium sp. 1996 1/1 1/1
Rf-89*, Rf-117 Phlox sp. 2004 1/2 0/1 (1)
Rf-116 Phlox divaricata 2007 1/1 nt
Rf-110; Rf-125 Phlox paniculata 2006 2/2 nt
Rf-61* Rudbeckia nitida 1997 1/1 1/1 no report
Rf-44*, Rf-45*, Rf-60*, Rf-71* Salvia superba 2000 4/4 1/3 (10)
Rf-122 Saponaria ocymoides 2009 1/1 nt no report
Rf-80*, Rf-92*, Rf-107 Sedum sp. 1996 3/3 2/3 (10)
Rf-112 Verbena 2006 1/1 nt (15)
Rf-65*, Rf-106 Veronica longifolia 1996 1/2 1/2 (10)
Rf-27*, Rf-36*, Rf-39*, Rf-41*, Rf-43*, Rf-47*, Rf-56*, Rf-70*, Rf-84*, Rf-87*, Rf-91*, Rf-100*, Rf-103, Rf-108, Rf-109, Rf-120 Veronica sp. 1996 16/16 13/13
Rf-76* Viola tricolor var. hortensis 1992 1/1 1/1 (10)
Total:    115/

117

66/

91

  

 x Rhodococcus fascians strains isolated from clinical samples submitted to the Pennsylvania Department of Agriculture (Harrisburg, PA) and identified by their cultural characteristics and sequences of the 16S rRNA gene (marked with *).

 y Real-time PCR results with primers Rf-229F/ Rf-408R and probe Rf-336P. Number of positive strains/Total tested strains.

 z Pea bioassay results reflect fasciation symptom development on pea seedlings at 14 days post-inoculation. Number of positive strains/Total tested strains. Based on our earlier study (7).



A
 
B

C
 
D

E
 
F

Fig. 2. Symptoms caused by Rhodococcus fascians on naturally infected plants from Pennsylvania greenhouses: (A) Ajania pacifica = Chrysanthemum pacificum (Japanese Chrysanthemum), (B) Anemone sp. (Anemone), (C) Lewisia sp. (Lewisia), (D) Monarda sp. (Horsemint), (E) Osteospermum ecklonis = Dimorphotheca ecklonis (Vanstaden’s River Daisy), and (F) Saponaria ocymoides (Rock Soapwort).


Summary and Conclusions

In this study, an RT PCR-based diagnostic method targeting the R. fascians plasmid-borne fas-1 gene (3) was developed and optimized to facilitate detection and quantification of R. fascians in plant samples. Quantification of R. fascians cells using the fas-1 gene in clinical plant samples is critical because the number of cells bearing this gene (and the virulence plasmid) determines the severity of symptom development (7). This diagnostic approach was shown to be more sensitive and faster than a conventional PCR or traditional pathogenicity test for detection of R. fascians (7,10,14).

Presence of PCR inhibitors is a common problem in directly detecting plant-associated bacteria by PCR in plant tissues, especially when concentrations of target pathogens are low (8,18). Employment of a sample DNA extraction and purification step using commercial kits is helpful, but requires extra resource. A combination of bacterial enrichment on semi-selective mD2 medium and RT PCR was successful for detection of R. fascians from clinical samples from Chrysanthemum, Heuchera, Pelargonium, Phlox, Veronica, and other hosts.

This is the first report describing an RT PCR-based diagnostic assay that allows simultaneous detection and isolation of pathogenic R. fascians from plant materials. For this assay, we recommend that 100 mg of infected plant tissues are suspended in sterile MGW for 30 min and that the resulting suspensions are plated on mD2 medium. After 5 to 7 day incubation at 27°C, yellow-orange colonies of presumptive R. fascians can be tested with fas-1 RT PCR. Positive colonies should be further purified before making storage stocks. This method can be used for effectively screening clinical samples from greenhouses and offers significant advantages over current detection techniques based on pathogenicity test. The rapid diagnosis will help growers prevent and control bacterial fasciation on geraniums and other ornamental plants. Additionally, the method can serve as a tool for studying the ecology and pathology of R. fascians.

The present study also showed a broad range of plants associated with R. fascians in Pennsylvania greenhouses with geraniums and speedwell being the most frequently submitted clinical samples to PDA. Ajania pacifica, Anemone sp., Aruncus sp., Baptisia sp., Eutrochium maculatum, Helianthemum sp., Lewisia sp., Monarda didyma, Monarda sp., Osteospermum ecklonis, Rudbeckia nitida, and Saponaria ocymoides, were found to be new plants associated with R. fascians.


Acknowledgments

This project was supported by grants from the Pennsylvania Department of Agriculture (ME442316 and ME 445580) and USDA-AMS Specialty Crop Block grants to Pennsylvania. We would like to thank the plant inspectors and technicians of the PDA for collecting or processing plant samples used in this study. Special thanks to Judy Maurice, Pennsylvania plant inspector, for her efforts in collecting plant samples.


Literature Cited

1. Baker, K. F. 1950. Bacterial fasciation disease of ornamental plants in California. Plant Dis. Reptr. 34:121-126.

2. Cooksey, D. A., and Keim, R. 1983. Association of Corynebacterium fascians with fasciation disease of Impatiens and Hebe in California. Plant Dis. 67:1389.

3. Crespi, M., Vereecke, D., Temmerman, W., Van Montagu, M., and Desomer, J. 1994. The fas operon of Rhodococcus fascians encodes new genes required for efficient fasciation of host plants. J. Bacteriol. 176:2492-2501.

4. Eason, R. J., Jameson, P. E., and Bannister, P. 1995. Virulence assessment of Rhodococcus fascians strains on pea cultivars. Plant Pathol. 44:141-147.

5. Kado, C. I., and Heskett, M. G. 1970. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas, and Xanthomonas. Phytopathology 60:969-976.

6. Lacey, M. S. 1939. Studies in bacteriosis. XXIV. Studies on a bacterium associated with leafy galls, fasciations and "cauliflower" disease of various plants. Part III. Further isolation, inoculation experiments and cultural studies. Ann. Appl. Biol. 26:262-278.

7. Nikolaeva, E. V., Park, S. Y., Kang S., Olson, T., and Kim, S. 2009. Ratios of cells with and without virulence genes in Rhodococcus fascians populations correlate with degrees of symptom development. Plant Dis. 93:499-506.

8. Ozakman, M., and Schaad, N. W. 2003. A real-time BIO-PCR assay for detection of Ralstonia solanocearum race 3, biovar 2, in asymptomatic potato tubers. Can. J. Plant Pathol. 25:232-239.

9. Pape, H. 1938. Eine noch wenig beachtete Krankheit der Zierpflanzen. Der Blumen-und Pflanzenbau die Gartenwelt 42: 384-386.

10. Putnam, M. L., and Miller, M. L. 2007. Rhodococcus fascians in Herbaceous Perennials. Plant Dis. 91:1064-1076.

11. Salm, H., and Geider, K. 2004. Real-time PCR for detection and quantification of Erwinia amylovora, the causal agent of fireblight. Plant Pathol. 53:602-610.

12. Schaad, N. W., Berthier-Schaad, Y., Sechler, A., and Knorr, D. 1999. Detection of Clavibacter michiganensis subsp. sepedonicus in potato tubers by BIO-PCR and an automated real-time fluorescence detection system. Plant Dis. 83:1095-1100.

13. Schaad, N. W., Opgenorth, D., and Gaush, P. 2002. Real-time polymerase reaction for one-hour on-site diagnosis of Pierce’s disease of grape in early season asymptomatic vines. Phytopathology 92:721-728.

14. Stange, R. R., Jeffares, D., Young, C., Scott, D. B., Eason, J. R., and Jameson, P. E. 1996. PCR amplification of the fas-1 gene for the detection of virulent strains of Rhodococcus fascians. Plant Pathol. 45:407-417.

15. Tilford, P. E. 1936. Fasciation of sweet pea caused by Phytomonas fascians n. sp. J. Agric. Res. 53:383-394.

16. Vereecke, D., Cornelis, K., Temmerman, W., Jaziri, M., Van Montagu, M., Holsters, M., and Goethals, K. 2002. Chromosomal locus that affects pathogenicity of Rhodococcus fascians. J. Bacteriol. 184:1112-1120.

17. Vereecke, D., Temmerman, W., Jaziri, M., Holsters, M., and Goethals, K. 2003. Toward an understanding of the Rhodococcus fascians - plant interaction. Pages 53-79 in: Plant-Microbe Interaction, Vol. 6. G. Stacy and N. Kech, eds. American Phytopathological Society, St. Paul, MN.

18. Weller, S. A., Elphinstone, J. G., Smith, N. C., Boonham, N., and Stead, D. E. 2000. Detection of Ralstonia solanocearum strains with a quantitative, multiplex, real-time, fluorogenic PCR (TaqMan) Assay. Appl. Environ. Microbiol. 66:2853-2858.

19. Weller, S. A., and Stead, D. E. 2002. Detection of root mat associated Agrobacterium strains from plant material and other sample types by post-enrichment TaqMan PCR. J. Appl. Microbiol. 92:118-126.

20. Yang, S., Lin, S., Kelen, G. D., Quinn, T. C., Dick, J. D., Gaydos, C. A., and Rothman, R. E. 2002. Quantitative Multiprobe PCR assay for simultaneous detection and identification to species level of bacterial pathogens. J. Clin. Microbiol. 40:3449-3454.