Table 2 from:


Everhart, S. E., Askew, A., Seymour, L., Glenn, T. C., and Scherm, H. 2012. Spatial patterns of brown rot epidemics and development of microsatellite markers for analyzing fine-scale genetic structure of Monilinia fructicola populations within peach tree canopies. Online. Plant Health Progress doi:10.1094/PHP-2012-0723-04-RS.



Table 2. Primer details, core sequences, allelic properties, and gene diversity (h) of 16 polymorphic PCR-based microsatellite markers developed for Monilinia fructicola and evaluated in a test population of 47 isolates.

Locus Primer sequence (5'-3') Repeat
motif
Cloned
allele

(bp)
Size
range

(bp)
No. of
alleles
No. of alleles for sub-populationsx h
Middle GA North GA Carolinas
Mf-SEA GAGTTTTCGGGATGGGGAG (CTTT)9 139 124-156 8 6 5 4 0.519
(CAG)-AACTGATATACGAACTTCTAGGAC
Mf-SEB (CAG)-AGGATTCGTCAAGAAGTCAATC (GGAT)10 129 119-231 16 7 9 8 0.905
TCTGCGTATTTATTACTTTGGGTAG
Mf-SEC CTCTCAACACCTGGGCATTC (AATC)5
(CATT)5
139 144-199 15 8 9 9 0.907
(CAG)-GAAGAGAGGGAAAGAGAGCG
Mf-SED (CAG)-TTGGCATGGCATTTGGAGC (GGAT)6 106 111-149 12 9 7 7 0.875
CCATTTTATTCATATCCAACGCCC
Mf-SEE (CAG)-TGGACCAACACAGCTACGG (GT)12 128 144-152 2 1 2 2 0.083
GGGTCCTCGCGTTTGATTTG
Mf-SEF TGTCTCTCAACTTTTAAATCAGCC (AATC)8 113 111-156 11 6 8 5 0.850
(CAG)-GACTATAGAGTTTTCTACGGATGG
Mf-SEG (CAG)-CCTACCCAATCTACCTAGTAACC (AGGATG)4 124 99-139 4 2 4 2 0.549
CCAAAGCAAAGTAGAGCAAAGC
Mf-SEI (CAG)-CTCAAGCGGTGGCTCAAAG (ATC)7 87 91-139 10 6 7 4 0.746
TAACCACCACGACCACGAC
Mf-SEJ (CAG)-TCCTTTCCGTTCCTCTTCCTG (CCTTT)4 89 97-132 6 6 8 3 0.735
CCGACGACAGACCAACAAAC
Mf-SEK (CAG)-GCTACTAAGAGCCTAGCG (CATT)6 227 228-268 13 7 6 9 0.872
TGCTTTACTGGAGCTGTGTTTG
Mf-SEL (CAG)-GAGTATAACCAACCCAACGGC (CATT)7 127 135-147 4 3 4 3 0.726
AGAGATGGAGTCAGGAGTGTTG
Mf-SEM (CAG)-GGGAGAGTGGGAGATTGGG (ACTC)7 108 121-187 12 9 7 6 0.892
GGGACCCTTGGACAGCAG
Mf-SEN (CAG)-TGCGTGTCATGTCGTCC (CT)12 138 219-252 5 3 5 4 0.742
CGAGGCTTAACTTCCGTGC
Mf-SEP (CAG)-TCCCATACTAGGCCACAGC (ACCT)6 233 242-270 8 5 6 2 0.629
ATCAATTGGTTTGGGTCCTTG
Mf-SEQ (CAG)-GGAGGTGGATGGTGGGTAG (AG)10 131 129-143 8 4 6 6 0.837
TGGCTGTGGGTTGAGTGAG
Mf-SER (CAG)-GCGTGCGGCCTATCAAAC (ACCT)6 117 130-182 10 6 7 4 0.722
TGCTTGGATTTTCTGTGAAGGG

 x Test populations were obtained from stone fruit production regions in middle Georgia (n = 14 isolates); north Georgia (n = 21); and North Carolina, South Carolina, and Virginia (n = 12).






2012 Plant Management Network.